Rh6CG501800

Belongs to the nucleosome assembly protein (NAP) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0001465
Physical Location & Seq
Forward (+)
66498088 .. 66499640
1553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG501800.1

Sequence Viewer

Length: 351 bp
ATGAGAATTGAAGCTAGATTTGTGACTGAATCTAGTATCGATCCTGAAGCAGATGGAGTTGGTAGTGATTCTGAAGAGGAAGCATTCGTCGATGAGAAAGGGGTGCCTAACTTCTGGCTCTATGCTTTGCAAAACAATGACTATATAGACAATGAGATCACTTATCGTGATCGTGATGAACAAGCTCTAAAATATCTTAAAGACATCAAGTGTTCCCCCATAGATGACTCCAAGGGATTCAAACTTGACTTCTGCTTTAAAGCCAATCCCTTCTTTAAAAACTCTGTCTTGACCAAGACATATCGCATGGTTGATGAGGATAGATCCCTTGTGAAGGATATAAAAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAP

Protein Analysis

116

Amino Acids

13.45

Weight (kDa)

4.56

Isoelectric Point (pI)

30.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAP PF00956 22 - 107 3.9e-28 Nucleosome assembly protein (NAP)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 103
AclWI GGATC 2 cut(s) 35, 318
AcuI CTGAAG 2 cut(s) 66, 93
AfiI CCNNNNNNNGG 1 cut(s) 334
AgsI TTSAA 2 cut(s) 11, 241
AluBI AGCT 2 cut(s) 14, 185
AluI AGCT 2 cut(s) 14, 185
AlwI GGATC 2 cut(s) 35, 318
BanI GGYRCC 1 cut(s) 103
BccI CCATC 1 cut(s) 47
BfaI CTAG 2 cut(s) 15, 33
BmiI GGNNCC 1 cut(s) 105
Bsa29I ATCGAT 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 231
Bsc4I CCNNNNNNNGG 1 cut(s) 334
BseCI ATCGAT 1 cut(s) 39
BseDI CCNNGG 1 cut(s) 231
BseLI CCNNNNNNNGG 1 cut(s) 334
BshNI GGYRCC 1 cut(s) 103
BshVI ATCGAT 1 cut(s) 39
BslI CCNNNNNNNGG 1 cut(s) 334
BsmI GAATGC 1 cut(s) 83
Bsp143I GATC 4 cut(s) 40, 156, 169, 323
BspDI ATCGAT 1 cut(s) 39
BspLI GGNNCC 1 cut(s) 105
BspPI GGATC 2 cut(s) 35, 318
BspT107I GGYRCC 1 cut(s) 103
BssECI CCNNGG 1 cut(s) 231
BssMI GATC 4 cut(s) 40, 156, 169, 323
BssT1I CCWWGG 1 cut(s) 231
Bst6I CTCTTC 1 cut(s) 69
BstENI CCTNNNNNAGG 1 cut(s) 332
BstKTI GATC 4 cut(s) 43, 159, 172, 326
BstMBI GATC 4 cut(s) 40, 156, 169, 323
BstX2I RGATCY 1 cut(s) 323
BstYI RGATCY 1 cut(s) 323
Bsu15I ATCGAT 1 cut(s) 39
BsuTUI ATCGAT 1 cut(s) 39
ClaI ATCGAT 1 cut(s) 39
CviAII CATG 1 cut(s) 307
CviJI RGCY 4 cut(s) 14, 118, 185, 263
CviKI_1 RGCY 4 cut(s) 14, 118, 185, 263
DpnI GATC 4 cut(s) 42, 158, 171, 325
DpnII GATC 4 cut(s) 40, 156, 169, 323
DraI TTTAAA 2 cut(s) 259, 277
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
Eco130I CCWWGG 1 cut(s) 231
Eco57I CTGAAG 2 cut(s) 66, 93
EcoNI CCTNNNNNAGG 1 cut(s) 332
EcoT14I CCWWGG 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 231
FaeI CATG 1 cut(s) 310
FaiI YATR 7 cut(s) 123, 144, 146, 221, 301, 308, 341
FatI CATG 1 cut(s) 306
FspBI CTAG 2 cut(s) 15, 33
Hin1II CATG 1 cut(s) 310
HinfI GANTC 4 cut(s) 29, 68, 227, 237
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 4 cut(s) 44, 167, 173, 289
Hpy99I CGWCG 1 cut(s) 92
HpyAV CCTTC 2 cut(s) 280, 328
HpyCH4V TGCA 1 cut(s) 130
Hsp92II CATG 1 cut(s) 310
Kzo9I GATC 4 cut(s) 40, 156, 169, 323
LpnPI CCDG 2 cut(s) 57, 100
MaeI CTAG 2 cut(s) 15, 33
MaeIII GTNAC 1 cut(s) 22
MalI GATC 4 cut(s) 42, 158, 171, 325
MboI GATC 4 cut(s) 40, 156, 169, 323
MboII GAAGA 1 cut(s) 86
MflI RGATCY 1 cut(s) 323
MluCI AATT 1 cut(s) 6
MlyI GAGTC 1 cut(s) 221
MnlI CCTC 2 cut(s) 70, 310
MseI TTAA 3 cut(s) 198, 258, 276
Mva1269I GAATGC 1 cut(s) 83
NdeII GATC 4 cut(s) 40, 156, 169, 323
NlaIII CATG 1 cut(s) 310
NlaIV GGNNCC 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 22
PctI GAATGC 1 cut(s) 83
PfeI GAWTC 3 cut(s) 29, 68, 237
PleI GAGTC 1 cut(s) 221
PpsI GAGTC 1 cut(s) 221
PspN4I GGNNCC 1 cut(s) 105
PsuI RGATCY 1 cut(s) 323
SaqAI TTAA 3 cut(s) 198, 258, 276
Sau3AI GATC 4 cut(s) 40, 156, 169, 323
SchI GAGTC 1 cut(s) 221
SetI ASST 2 cut(s) 16, 187
Sse9I AATT 1 cut(s) 6
SspMI CTAG 2 cut(s) 15, 33
StyI CCWWGG 1 cut(s) 231
TaqI TCGA 2 cut(s) 39, 90
TasI AATT 1 cut(s) 6
TfiI GAWTC 3 cut(s) 29, 68, 237
Tru1I TTAA 3 cut(s) 198, 258, 276
Tru9I TTAA 3 cut(s) 198, 258, 276
TseFI GTSAC 1 cut(s) 22
Tsp45I GTSAC 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 192
XagI CCTNNNNNAGG 1 cut(s) 332
XspI CTAG 2 cut(s) 15, 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.