Rh5DG185000

GTP1/OBG

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
20545613 .. 20567537
21925 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG185000.1

Sequence Viewer

Length: 186 bp
ATGGTTGATTCATATGCACTAAAGAAGGACAAAAAGAAAGGGGTGCCTAACTTCTGGCTCTATGCATTGCAAAACAATGACTATATAGACGAGGAGATTAGCTTGGTAGAAATGCCAGAGCGTAGCAAGAAAAAGTTGATGGCTTTGACCACTAATGTGATGAGAGATGATAGTGATAAGCGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.21

Weight (kDa)

7.94

Isoelectric Point (pI)

51.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 43
AleI CACNNNNGTG 1 cut(s) 155
AluBI AGCT 1 cut(s) 102
AluI AGCT 1 cut(s) 102
BanI GGYRCC 1 cut(s) 43
BccI CCATC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 45
Bse3DI GCAATG 1 cut(s) 65
BseMI GCAATG 1 cut(s) 65
BseRI GAGGAG 1 cut(s) 107
BshNI GGYRCC 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 45
BspT107I GGYRCC 1 cut(s) 43
BsrDI GCAATG 1 cut(s) 65
CviJI RGCY 3 cut(s) 58, 102, 143
CviKI_1 RGCY 3 cut(s) 58, 102, 143
EcoT22I ATGCAT 1 cut(s) 67
FaiI YATR 5 cut(s) 13, 15, 63, 84, 86
FauNDI CATATG 1 cut(s) 13
HinfI GANTC 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 19
HpyCH4V TGCA 3 cut(s) 17, 65, 70
LpnPI CCDG 2 cut(s) 40, 129
MnlI CCTC 1 cut(s) 85
Mph1103I ATGCAT 1 cut(s) 67
MslI CAYNNNNRTG 1 cut(s) 155
NdeI CATATG 1 cut(s) 13
NlaIV GGNNCC 1 cut(s) 45
NsiI ATGCAT 1 cut(s) 67
OliI CACNNNNGTG 1 cut(s) 155
PfeI GAWTC 1 cut(s) 8
PspN4I GGNNCC 1 cut(s) 45
RseI CAYNNNNRTG 1 cut(s) 155
SetI ASST 1 cut(s) 104
SgeI CNNG 5 cut(s) 67, 103, 115, 128, 139
SmiMI CAYNNNNRTG 1 cut(s) 155
TfiI GAWTC 1 cut(s) 8
Zsp2I ATGCAT 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.