Rh5AG280500

Belongs to the nucleosome assembly protein (NAP) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0001465
Physical Location & Seq
Reverse (-)
37970499 .. 37972111
1613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG280500.1

Sequence Viewer

Length: 225 bp
ATGATCTTTGACATAACATGCTTCAAACAAAAGATTAAGTATCAGGATCAATGTTTGGATGACGTTAAAGAAGAATATGAAGGGAACTGTTATAGGAGGAGTGCAAGCTATGCTTCTACAGAGAAAGGGGTGCCTAACTTCTGGCTCTATGCATTGCAAAACAATGACTATATAGACGAGGAGATTACTTATCGTGATGAGCGAGGGGTGGACAAGGAGGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAP

Protein Analysis

74

Amino Acids

8.85

Weight (kDa)

4.5

Isoelectric Point (pI)

42.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAP PF00956 27 - 68 2.7e-07 Nucleosome assembly protein (NAP)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 130
AclWI GGATC 1 cut(s) 54
AgsI TTSAA 1 cut(s) 25
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
AlwI GGATC 1 cut(s) 54
BanI GGYRCC 1 cut(s) 130
BfmI CTRYAG 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 132
Bse3DI GCAATG 1 cut(s) 152
BseGI GGATG 1 cut(s) 64
BseMI GCAATG 1 cut(s) 152
BseRI GAGGAG 2 cut(s) 112, 194
BshNI GGYRCC 1 cut(s) 130
Bsp143I GATC 2 cut(s) 3, 46
BspLI GGNNCC 1 cut(s) 132
BspPI GGATC 1 cut(s) 54
BspT107I GGYRCC 1 cut(s) 130
BsrDI GCAATG 1 cut(s) 152
BssMI GATC 2 cut(s) 3, 46
Bst4CI ACNGT 1 cut(s) 89
BstAPI GCANNNNNTGC 1 cut(s) 110
BstC8I GCNNGC 1 cut(s) 106
BstF5I GGATG 1 cut(s) 64
BstKTI GATC 2 cut(s) 6, 49
BstMBI GATC 2 cut(s) 3, 46
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 21
BstSFI CTRYAG 1 cut(s) 117
BtsCI GGATG 1 cut(s) 64
Cac8I GCNNGC 1 cut(s) 106
CviAII CATG 1 cut(s) 18
CviJI RGCY 2 cut(s) 108, 145
CviKI_1 RGCY 2 cut(s) 108, 145
DpnI GATC 2 cut(s) 5, 48
DpnII GATC 2 cut(s) 3, 46
EcoT22I ATGCAT 1 cut(s) 154
FaeI CATG 1 cut(s) 21
FaiI YATR 8 cut(s) 14, 19, 78, 93, 111, 150, 171, 173
FalI AAGNNNNNCTT 2 cut(s) 97, 129
FatI CATG 1 cut(s) 17
FokI GGATG 1 cut(s) 71
Hin1II CATG 1 cut(s) 21
Hpy166II GTNNAC 1 cut(s) 211
Hpy188III TCNNGA 2 cut(s) 44, 194
Hpy8I GTNNAC 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 74
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 3 cut(s) 104, 152, 157
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 1 cut(s) 21
Kzo9I GATC 2 cut(s) 3, 46
LpnPI CCDG 2 cut(s) 29, 127
MaeII ACGT 1 cut(s) 63
MalI GATC 2 cut(s) 5, 48
MboI GATC 2 cut(s) 3, 46
MboII GAAGA 1 cut(s) 83
MnlI CCTC 4 cut(s) 90, 172, 197, 211
Mph1103I ATGCAT 1 cut(s) 154
MseI TTAA 2 cut(s) 36, 66
MwoI GCNNNNNNNGC 1 cut(s) 110
NdeII GATC 2 cut(s) 3, 46
NlaIII CATG 1 cut(s) 21
NlaIV GGNNCC 1 cut(s) 132
NsiI ATGCAT 1 cut(s) 154
NspI RCATGY 1 cut(s) 21
PcsI WCGNNNNNNNCGW 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 132
SaqAI TTAA 2 cut(s) 36, 66
Sau3AI GATC 2 cut(s) 3, 46
SetI ASST 2 cut(s) 66, 110
SfcI CTRYAG 1 cut(s) 117
SgeI CNNG 7 cut(s) 30, 56, 117, 154, 190, 206, 215
TaaI ACNGT 1 cut(s) 89
TaiI ACGT 1 cut(s) 66
Tru1I TTAA 2 cut(s) 36, 66
Tru9I TTAA 2 cut(s) 36, 66
TspDTI ATGAA 1 cut(s) 93
XceI RCATGY 1 cut(s) 21
Zsp2I ATGCAT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.