Rh5AG529400

GTP1/OBG

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
90870712 .. 90874933
4222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG529400.1

Sequence Viewer

Length: 165 bp
ATGGGAGAGAAAGGGGTGCCTAACTTCTGGCTCTATGCATTGCAAAACAATGACTATATAGACGAGGAGATTAGCTTGGTAGAAATGCCAGAGCGTAGCAAGAAAAAGTTGATGGCTTTGACCACTAATGTGATGAGAGATGATAGTGATAAGGGCCTTGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.19

Weight (kDa)

4.65

Isoelectric Point (pI)

46.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 16
AleI CACNNNNGTG 1 cut(s) 128
AluBI AGCT 1 cut(s) 75
AluI AGCT 1 cut(s) 75
AoxI GGCC 1 cut(s) 154
AspS9I GGNCC 1 cut(s) 154
BanI GGYRCC 1 cut(s) 16
BccI CCATC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 154
BmiI GGNNCC 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 157
Bse3DI GCAATG 1 cut(s) 38
BseDI CCNNGG 1 cut(s) 157
BseMI GCAATG 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 80
BshFI GGCC 1 cut(s) 156
BshNI GGYRCC 1 cut(s) 16
BsnI GGCC 1 cut(s) 156
BspANI GGCC 1 cut(s) 156
BspLI GGNNCC 1 cut(s) 18
BspT107I GGYRCC 1 cut(s) 16
BsrDI GCAATG 1 cut(s) 38
BssECI CCNNGG 1 cut(s) 157
BssT1I CCWWGG 1 cut(s) 157
BsuRI GGCC 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 154
CviJI RGCY 4 cut(s) 31, 75, 116, 156
CviKI_1 RGCY 4 cut(s) 31, 75, 116, 156
Eco130I CCWWGG 1 cut(s) 157
EcoO109I RGGNCCY 1 cut(s) 154
EcoT14I CCWWGG 1 cut(s) 157
EcoT22I ATGCAT 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 157
FaiI YATR 3 cut(s) 36, 57, 59
HaeIII GGCC 1 cut(s) 156
HpyCH4V TGCA 2 cut(s) 38, 43
LpnPI CCDG 2 cut(s) 13, 102
MnlI CCTC 1 cut(s) 58
Mph1103I ATGCAT 1 cut(s) 40
MslI CAYNNNNRTG 1 cut(s) 128
NlaIV GGNNCC 1 cut(s) 18
NsiI ATGCAT 1 cut(s) 40
OliI CACNNNNGTG 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 18
PspPI GGNCC 1 cut(s) 154
RseI CAYNNNNRTG 1 cut(s) 128
Sau96I GGNCC 1 cut(s) 154
SetI ASST 1 cut(s) 77
SgeI CNNG 5 cut(s) 40, 76, 88, 101, 112
SmiMI CAYNNNNRTG 1 cut(s) 128
StyI CCWWGG 1 cut(s) 157
Zsp2I ATGCAT 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.