RchiOBHm_Chr6g0269661

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001411
Physical Location & Seq
Reverse (-)
26982887 .. 26985628
2742 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24189

Sequence Viewer

Length: 291 bp
ATGCAAATGCAACAACAACAAATTCATCTACTAATAATGAGGGTGAATCCAATGAAGCAAATGGAGAAGCATATCAAGACACTCATTGTCCTATCTCACTACTTGGAGATGCAGTCTTTTTCCTCTCCATTGTCTACCATACTAAGCAAGCTCAAGAGTCAAGACTCCACAACTCCCAAAAGGTTCTTATTTTGGCAAGGACAAATCATTGGAGTTCATGCAGCTCTGCATCTATTTAAGGTTGATAGAACATACCTAATGACAAGTATGGTAGTTACGGTACATTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

11.27

Weight (kDa)

10.09

Isoelectric Point (pI)

36.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 134
AcsI RAATTY 1 cut(s) 21
AfaI GTAC 1 cut(s) 282
AluBI AGCT 2 cut(s) 151, 224
AluI AGCT 2 cut(s) 151, 224
ApeKI GCWGC 1 cut(s) 221
ApoI RAATTY 1 cut(s) 21
AsuHPI GGTGA 1 cut(s) 55
BbvI GCAGC 1 cut(s) 233
BisI GCNGC 1 cut(s) 222
BlsI GCNGC 1 cut(s) 223
BmsI GCATC 2 cut(s) 99, 238
BpuEI CTTGAG 1 cut(s) 137
BsaXI ACNNNNNCTCC 2 cut(s) 98, 128
BseXI GCAGC 1 cut(s) 233
Bst4CI ACNGT 1 cut(s) 280
BstC8I GCNNGC 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 143
BstV1I GCAGC 1 cut(s) 233
Cac8I GCNNGC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 281
CviAII CATG 1 cut(s) 218
CviJI RGCY 2 cut(s) 151, 224
CviKI_1 RGCY 2 cut(s) 151, 224
CviQI GTAC 1 cut(s) 281
DdeI CTNAG 1 cut(s) 143
FaeI CATG 1 cut(s) 221
FaiI YATR 5 cut(s) 72, 140, 219, 253, 269
FatI CATG 1 cut(s) 217
FblI GTMKAC 1 cut(s) 134
Fnu4HI GCNGC 1 cut(s) 222
Fsp4HI GCNGC 1 cut(s) 222
GluI GCNGC 1 cut(s) 222
Hin1II CATG 1 cut(s) 221
HinfI GANTC 3 cut(s) 46, 157, 164
HphI GGTGA 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 135
Hpy188III TCNNGA 3 cut(s) 76, 154, 161
Hpy8I GTNNAC 1 cut(s) 135
HpyCH4III ACNGT 1 cut(s) 280
HpyCH4V TGCA 5 cut(s) 4, 10, 112, 221, 229
HpyF3I CTNAG 1 cut(s) 143
Hsp92II CATG 1 cut(s) 221
Lsp1109I GCAGC 1 cut(s) 233
LweI GCATC 2 cut(s) 99, 238
MaeIII GTNAC 1 cut(s) 274
MluCI AATT 1 cut(s) 21
MlyI GAGTC 2 cut(s) 158, 166
MnlI CCTC 2 cut(s) 33, 133
MseI TTAA 2 cut(s) 237, 289
NlaIII CATG 1 cut(s) 221
PfeI GAWTC 1 cut(s) 46
PkrI GCNGC 1 cut(s) 223
PleI GAGTC 2 cut(s) 158, 165
PpsI GAGTC 2 cut(s) 158, 165
RsaI GTAC 1 cut(s) 282
RsaNI GTAC 1 cut(s) 281
SaqAI TTAA 2 cut(s) 237, 289
SatI GCNGC 1 cut(s) 222
SchI GAGTC 2 cut(s) 158, 166
SetI ASST 5 cut(s) 153, 185, 226, 243, 258
SfaNI GCATC 2 cut(s) 99, 238
SgeI CNNG 8 cut(s) 88, 115, 160, 166, 173, 209, 230, 276
SmlI CTYRAG 1 cut(s) 152
SmoI CTYRAG 1 cut(s) 152
Sse9I AATT 1 cut(s) 21
TaaI ACNGT 1 cut(s) 280
TasI AATT 1 cut(s) 21
TfiI GAWTC 1 cut(s) 46
Tru1I TTAA 2 cut(s) 237, 289
Tru9I TTAA 2 cut(s) 237, 289
TseI GCWGC 1 cut(s) 221
TspDTI ATGAA 3 cut(s) 14, 68, 206
XapI RAATTY 1 cut(s) 21
XmiI GTMKAC 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.