Rh4BG140300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
24901618 .. 24901944
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG140300.1

Sequence Viewer

Length: 156 bp
ATGGAGAAGCATATCAAGACACTCATTGTCCTATCTCACTACTTGGAGGTGCAGTCTTTTTCCTCTCCATTGTCTACCATACTAAGCAAGCTCAAGAGTCAAGACTCCACAACTCCCAAAAGGGAAATTATGACTTTGCTCCAAGCTAAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.82

Weight (kDa)

9.22

Isoelectric Point (pI)

72.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 74
AluBI AGCT 2 cut(s) 91, 146
AluI AGCT 2 cut(s) 91, 146
BfaI CTAG 1 cut(s) 154
BpuEI CTTGAG 1 cut(s) 77
BsaXI ACNNNNNCTCC 2 cut(s) 38, 68
BsgI GTGCAG 1 cut(s) 71
BstC8I GCNNGC 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 89
CviJI RGCY 2 cut(s) 91, 146
CviKI_1 RGCY 2 cut(s) 91, 146
DdeI CTNAG 1 cut(s) 83
FaiI YATR 3 cut(s) 12, 80, 131
FblI GTMKAC 1 cut(s) 74
FspBI CTAG 1 cut(s) 154
HinfI GANTC 2 cut(s) 97, 104
Hpy166II GTNNAC 1 cut(s) 75
Hpy188III TCNNGA 3 cut(s) 16, 94, 101
Hpy8I GTNNAC 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 83
LmnI GCTCC 1 cut(s) 144
MaeI CTAG 1 cut(s) 154
MluCI AATT 1 cut(s) 126
MlyI GAGTC 2 cut(s) 98, 106
MnlI CCTC 2 cut(s) 40, 73
PleI GAGTC 2 cut(s) 98, 105
PpsI GAGTC 2 cut(s) 98, 105
SchI GAGTC 2 cut(s) 98, 106
SetI ASST 3 cut(s) 51, 93, 148
SgeI CNNG 5 cut(s) 28, 55, 100, 106, 113
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 1 cut(s) 126
SspMI CTAG 1 cut(s) 154
TasI AATT 1 cut(s) 126
XmiI GTMKAC 1 cut(s) 74
XspI CTAG 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.