Rh3DG266800

Component of the DNA topoisomerase VI involved in chromatin organization and progression of endoreduplication cycles. Relaxes both positive and negative superturns and exhibits a strong decatenase activity. The B subunit binds ATP

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
26645297 .. 26649942
4646 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG266800.1

Sequence Viewer

Length: 222 bp
ATGAAATCTCCAGCTGGGTTCTTCGTTGAGAACAAGAACATTGCTGGATTTGGGAAATGTCTTTATACTACTATGAGGGAACTTGTGGAGAACTCATTTGATTCGACGGAGTCCATATCGGAGCTTCCTCTGATAGAAATCACAATGTTGTTCACGTCTGTGATGGCTTGTATTATTAGTTGGGAATTCTTCAACAAGGAAATAAAGGAGACATGCACCTAG

Protein Analysis

73

Amino Acids

8.31

Weight (kDa)

4.61

Isoelectric Point (pI)

67.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 185
AgsI TTSAA 1 cut(s) 193
AjiI CACGTC 1 cut(s) 156
AleI CACNNNNGTG 1 cut(s) 158
AluBI AGCT 2 cut(s) 14, 124
AluI AGCT 2 cut(s) 14, 124
Alw26I GTCTC 1 cut(s) 203
ApoI RAATTY 1 cut(s) 185
BccI CCATC 1 cut(s) 157
BcoDI GTCTC 1 cut(s) 203
BfaI CTAG 1 cut(s) 220
BmgBI CACGTC 1 cut(s) 156
BsaBI GATNNNNATC 1 cut(s) 137
Bse3DI GCAATG 1 cut(s) 39
Bse8I GATNNNNATC 1 cut(s) 137
BseJI GATNNNNATC 1 cut(s) 137
BseMI GCAATG 1 cut(s) 39
BseYI CCCAGC 1 cut(s) 14
BsmAI GTCTC 1 cut(s) 203
BsrDI GCAATG 1 cut(s) 39
BstMAI GTCTC 1 cut(s) 203
BstNSI RCATGY 1 cut(s) 216
BtrI CACGTC 1 cut(s) 156
CviAII CATG 1 cut(s) 213
CviJI RGCY 3 cut(s) 14, 124, 167
CviKI_1 RGCY 3 cut(s) 14, 124, 167
EcoRI GAATTC 1 cut(s) 185
FaeI CATG 1 cut(s) 216
FaiI YATR 4 cut(s) 66, 74, 116, 214
FatI CATG 1 cut(s) 212
FspBI CTAG 1 cut(s) 220
GsaI CCCAGC 1 cut(s) 18
Hin1II CATG 1 cut(s) 216
HinfI GANTC 2 cut(s) 101, 110
Hpy166II GTNNAC 1 cut(s) 153
Hpy188I TCNGA 2 cut(s) 121, 132
Hpy8I GTNNAC 1 cut(s) 153
Hpy99I CGWCG 1 cut(s) 109
HpyCH4IV ACGT 1 cut(s) 155
HpyCH4V TGCA 1 cut(s) 216
HpySE526I ACGT 1 cut(s) 155
Hsp92II CATG 1 cut(s) 216
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 2 cut(s) 24, 30
MaeI CTAG 1 cut(s) 220
MaeII ACGT 1 cut(s) 155
MboII GAAGA 2 cut(s) 13, 181
MluCI AATT 1 cut(s) 185
MlyI GAGTC 1 cut(s) 119
MnlI CCTC 2 cut(s) 69, 138
MslI CAYNNNNRTG 1 cut(s) 158
MspA1I CMGCKG 1 cut(s) 14
NlaIII CATG 1 cut(s) 216
NspI RCATGY 1 cut(s) 216
OliI CACNNNNGTG 1 cut(s) 158
PfeI GAWTC 1 cut(s) 101
PflFI GACNNNGTC 1 cut(s) 109
PleI GAGTC 1 cut(s) 118
PpsI GAGTC 1 cut(s) 118
PspFI CCCAGC 1 cut(s) 14
PsyI GACNNNGTC 1 cut(s) 109
PvuII CAGCTG 1 cut(s) 14
RseI CAYNNNNRTG 1 cut(s) 158
SchI GAGTC 1 cut(s) 119
SetI ASST 4 cut(s) 16, 126, 158, 221
SgeI CNNG 8 cut(s) 23, 27, 46, 57, 95, 166, 180, 208
SmiMI CAYNNNNRTG 1 cut(s) 158
Sse9I AATT 1 cut(s) 185
SspMI CTAG 1 cut(s) 220
TaiI ACGT 1 cut(s) 158
TaqI TCGA 1 cut(s) 104
TasI AATT 1 cut(s) 185
TfiI GAWTC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 122
Tth111I GACNNNGTC 1 cut(s) 109
XapI RAATTY 1 cut(s) 185
XceI RCATGY 1 cut(s) 216
XspI CTAG 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.