Rh2CG235800

Component of the DNA topoisomerase VI involved in chromatin organization and progression of endoreduplication cycles. Relaxes both positive and negative superturns and exhibits a strong decatenase activity. The B subunit binds ATP

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
24297986 .. 24300526
2541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG235800.1

Sequence Viewer

Length: 183 bp
ATGTCTCAAGAGGAGGATGCTTCACGATATGGAGAATCTCCAGCTGAGTTCTTCGCTGAGAACATTGCTGGATTTGGTAATCCAGGGAAATGTCTTTATACTACTGTGAGGGAACTTGTGGAGAACTCATTTGATTCGACGGAGTCCATGTCGGAGCTTCCTCTGATAGAAATCACAATGTGA

Protein Analysis

60

Amino Acids

6.67

Weight (kDa)

4.05

Isoelectric Point (pI)

87.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 180
AjnI CCWGG 1 cut(s) 82
AluBI AGCT 2 cut(s) 44, 157
AluI AGCT 2 cut(s) 44, 157
Alw26I GTCTC 1 cut(s) 9
BciT130I CCWGG 1 cut(s) 84
BcoDI GTCTC 1 cut(s) 9
Bme1390I CCNGG 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 84
BmsI GCATC 1 cut(s) 7
BpmI CTGGAG 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 170
BsaJI CCNNGG 1 cut(s) 83
BsaXI ACNNNNNCTCC 2 cut(s) 134, 164
Bse3DI GCAATG 1 cut(s) 63
Bse8I GATNNNNATC 1 cut(s) 170
BseBI CCWGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 83
BseGI GGATG 1 cut(s) 22
BseJI GATNNNNATC 1 cut(s) 170
BseMI GCAATG 1 cut(s) 63
BseMII CTCAG 2 cut(s) 36, 48
BseRI GAGGAG 1 cut(s) 26
BsmAI GTCTC 1 cut(s) 9
BspCNI CTCAG 2 cut(s) 37, 49
BsrDI GCAATG 1 cut(s) 63
BssECI CCNNGG 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 84
Bst4CI ACNGT 1 cut(s) 106
BstDEI CTNAG 2 cut(s) 45, 57
BstF5I GGATG 1 cut(s) 22
BstMAI GTCTC 1 cut(s) 9
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 82
BtsCI GGATG 1 cut(s) 22
CviAII CATG 1 cut(s) 148
CviJI RGCY 2 cut(s) 44, 157
CviKI_1 RGCY 2 cut(s) 44, 157
DdeI CTNAG 2 cut(s) 45, 57
DraIII CACNNNGTG 1 cut(s) 180
EcoRII CCWGG 1 cut(s) 82
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 30, 99, 149
FatI CATG 1 cut(s) 147
FokI GGATG 1 cut(s) 29
GsuI CTGGAG 1 cut(s) 24
Hin1II CATG 1 cut(s) 151
HinfI GANTC 3 cut(s) 35, 134, 143
Hpy188I TCNGA 2 cut(s) 154, 165
Hpy188III TCNNGA 2 cut(s) 8, 24
Hpy99I CGWCG 1 cut(s) 142
HpyCH4III ACNGT 1 cut(s) 106
HpyF3I CTNAG 2 cut(s) 45, 57
Hsp92II CATG 1 cut(s) 151
LmnI GCTCC 1 cut(s) 154
LpnPI CCDG 4 cut(s) 54, 54, 69, 96
LweI GCATC 1 cut(s) 7
MboII GAAGA 1 cut(s) 43
MlyI GAGTC 1 cut(s) 152
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 4 cut(s) 4, 7, 102, 171
MspA1I CMGCKG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 84
MvaI CCWGG 1 cut(s) 84
NlaIII CATG 1 cut(s) 151
PfeI GAWTC 2 cut(s) 35, 134
PflFI GACNNNGTC 1 cut(s) 142
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
PsyI GACNNNGTC 1 cut(s) 142
PvuII CAGCTG 1 cut(s) 44
SchI GAGTC 1 cut(s) 152
ScrFI CCNGG 1 cut(s) 84
SetI ASST 2 cut(s) 46, 159
SfaNI GCATC 1 cut(s) 7
SgeI CNNG 8 cut(s) 20, 36, 53, 81, 95, 96, 128, 160
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 82
TaaI ACNGT 1 cut(s) 106
TaqI TCGA 1 cut(s) 137
TfiI GAWTC 2 cut(s) 35, 134
TspGWI ACGGA 1 cut(s) 155
Tth111I GACNNNGTC 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.