Rh6AG196800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0001411
Physical Location & Seq
Forward (+)
35271378 .. 35287354
15977 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG196800.1

Sequence Viewer

Length: 261 bp
ATGGAGAAGCATATCAAGACACTCATTGTCCTATCTCACTACTTGGAGGTGCAGTCTTTTTCCTCTCCATTGTCCACCATACTAAGCAAGCTCAAGAGTCAAGACTCCACAACTCCCAAAAGAATTAAGCGCATCTCTACAATAACCTTAACAACAATCACATTGGCATCACAAATTCTCGTAGAGGTAGCAAAGATTGGGAGGCCATCCACATTCCTCAATACAAAACCAATAAAGGCACCACCATATTACTTGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.64

Weight (kDa)

10.14

Isoelectric Point (pI)

56.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 238
AcsI RAATTY 1 cut(s) 174
AgsI TTSAA 1 cut(s) 256
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
AoxI GGCC 1 cut(s) 203
ApoI RAATTY 1 cut(s) 174
AspLEI GCGC 1 cut(s) 132
BanI GGYRCC 1 cut(s) 238
BccI CCATC 1 cut(s) 214
BfaI CTAG 1 cut(s) 259
BmiI GGNNCC 1 cut(s) 240
BmsI GCATC 2 cut(s) 141, 176
BpuEI CTTGAG 1 cut(s) 77
BsaXI ACNNNNNCTCC 2 cut(s) 38, 68
BseGI GGATG 1 cut(s) 206
BsgI GTGCAG 1 cut(s) 71
BshFI GGCC 1 cut(s) 205
BshNI GGYRCC 1 cut(s) 238
BsnI GGCC 1 cut(s) 205
BspANI GGCC 1 cut(s) 205
BspLI GGNNCC 1 cut(s) 240
BspT107I GGYRCC 1 cut(s) 238
BstC8I GCNNGC 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 83
BstF5I GGATG 1 cut(s) 206
BstHHI GCGC 1 cut(s) 132
BsuRI GGCC 1 cut(s) 205
BtsCI GGATG 1 cut(s) 206
Cac8I GCNNGC 1 cut(s) 89
CfoI GCGC 1 cut(s) 132
CviJI RGCY 2 cut(s) 91, 205
CviKI_1 RGCY 2 cut(s) 91, 205
DdeI CTNAG 1 cut(s) 83
FaiI YATR 3 cut(s) 12, 80, 247
FokI GGATG 1 cut(s) 193
FspBI CTAG 1 cut(s) 259
GlaI GCGC 1 cut(s) 131
HaeIII GGCC 1 cut(s) 205
HhaI GCGC 1 cut(s) 132
Hin6I GCGC 1 cut(s) 130
HinP1I GCGC 1 cut(s) 130
HinfI GANTC 2 cut(s) 97, 104
Hpy166II GTNNAC 1 cut(s) 75
Hpy188III TCNNGA 3 cut(s) 16, 94, 101
Hpy8I GTNNAC 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 83
HspAI GCGC 1 cut(s) 130
LweI GCATC 2 cut(s) 141, 176
MaeI CTAG 1 cut(s) 259
MluCI AATT 2 cut(s) 123, 174
MlyI GAGTC 2 cut(s) 98, 106
MnlI CCTC 5 cut(s) 40, 73, 178, 195, 227
MseI TTAA 2 cut(s) 126, 149
NlaIV GGNNCC 1 cut(s) 240
PleI GAGTC 2 cut(s) 98, 105
PpsI GAGTC 2 cut(s) 98, 105
PspN4I GGNNCC 1 cut(s) 240
SaqAI TTAA 2 cut(s) 126, 149
SchI GAGTC 2 cut(s) 98, 106
SetI ASST 4 cut(s) 51, 93, 149, 189
SfaNI GCATC 2 cut(s) 141, 176
SgeI CNNG 6 cut(s) 28, 55, 100, 106, 113, 191
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 2 cut(s) 123, 174
SspMI CTAG 1 cut(s) 259
TasI AATT 2 cut(s) 123, 174
Tru1I TTAA 2 cut(s) 126, 149
Tru9I TTAA 2 cut(s) 126, 149
XapI RAATTY 1 cut(s) 174
XspI CTAG 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.