Rh4CG033900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
6982994 .. 6991134
8141 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG033900.1

Sequence Viewer

Length: 285 bp
ATGAGATCATCAAGATTGGGAATCAAGAAGGGGGGATTTGCAACATATTTGGGATCACAAATGGAGAAGCATATCAAGACACTCATTGTCCTATCTCACTACTTGGAGGTGCAGTCTCCATTGTCCACCATACTAAGCAAGCTCAAGACTCCACAACTCCCAAAATTTCTTCCCCAATTTTCAAACTATTTGCAACACCAGAAACTCATAGCAGAAGAAAAATCCAACACCTCAATGTACTCACAACTTGCATCAGACACTTATGCAATATCCTCATGGGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.64

Weight (kDa)

9.74

Isoelectric Point (pI)

54.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AcsI RAATTY 1 cut(s) 164
AfaI GTAC 1 cut(s) 239
AgsI TTSAA 1 cut(s) 183
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
Alw26I GTCTC 1 cut(s) 120
AlwI GGATC 1 cut(s) 61
ApoI RAATTY 1 cut(s) 164
BcoDI GTCTC 1 cut(s) 120
BmsI GCATC 1 cut(s) 260
BpuEI CTTGAG 1 cut(s) 128
BsaXI ACNNNNNCTCC 2 cut(s) 98, 128
BsgI GTGCAG 1 cut(s) 131
BsmAI GTCTC 1 cut(s) 120
Bsp143I GATC 2 cut(s) 5, 53
BspPI GGATC 1 cut(s) 61
BssMI GATC 2 cut(s) 5, 53
BstC8I GCNNGC 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 134
BstKTI GATC 2 cut(s) 8, 56
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 2 cut(s) 5, 53
Cac8I GCNNGC 1 cut(s) 140
Csp6I GTAC 1 cut(s) 238
CviAII CATG 1 cut(s) 276
CviJI RGCY 1 cut(s) 142
CviKI_1 RGCY 1 cut(s) 142
CviQI GTAC 1 cut(s) 238
DdeI CTNAG 1 cut(s) 134
DpnI GATC 2 cut(s) 7, 55
DpnII GATC 2 cut(s) 5, 53
FaeI CATG 1 cut(s) 279
FaiI YATR 7 cut(s) 46, 72, 131, 209, 264, 277, 283
FatI CATG 1 cut(s) 275
Hin1II CATG 1 cut(s) 279
HinfI GANTC 2 cut(s) 21, 148
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 4 cut(s) 12, 25, 76, 145
Hpy8I GTNNAC 1 cut(s) 126
HpyAV CCTTC 1 cut(s) 22
HpyCH4V TGCA 5 cut(s) 41, 112, 193, 251, 266
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 1 cut(s) 279
Kzo9I GATC 2 cut(s) 5, 53
LpnPI CCDG 1 cut(s) 212
LweI GCATC 1 cut(s) 260
MalI GATC 2 cut(s) 7, 55
MboI GATC 2 cut(s) 5, 53
MboII GAAGA 2 cut(s) 161, 227
MluCI AATT 2 cut(s) 164, 176
MlyI GAGTC 1 cut(s) 142
MmeI TCCRAC 1 cut(s) 249
MnlI CCTC 3 cut(s) 100, 241, 283
MslI CAYNNNNRTG 1 cut(s) 233
NdeII GATC 2 cut(s) 5, 53
NlaIII CATG 1 cut(s) 279
PfeI GAWTC 1 cut(s) 21
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
RsaI GTAC 1 cut(s) 239
RsaNI GTAC 1 cut(s) 238
RseI CAYNNNNRTG 1 cut(s) 233
Sau3AI GATC 2 cut(s) 5, 53
SchI GAGTC 1 cut(s) 142
SetI ASST 3 cut(s) 111, 144, 233
SfaNI GCATC 1 cut(s) 260
SgeI CNNG 8 cut(s) 24, 37, 88, 115, 151, 157, 211, 260
SmiMI CAYNNNNRTG 1 cut(s) 233
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
Sse9I AATT 2 cut(s) 164, 176
TasI AATT 2 cut(s) 164, 176
TatI WGTACW 1 cut(s) 237
TfiI GAWTC 1 cut(s) 21
XapI RAATTY 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.