Rmu_sc0003198.1_g000001
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003198.1
Physical Location & Seq
Reverse (-)
2653 .. 2993
341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003198.1_g000001.1.cds

Sequence Viewer

Length: 249 bp
atgtccaatggcagtgtggcttctcgtgtcaaagggaaaccagtgttggattggggaactaggaaactaatttccttgggagctgcaagaggatcgttataccttcatgagcagtgtgacccgaaaattatccacaaggatgtgaaggtagcaaatgtacttcttgatgactattgtgaagccgtggttggagattttgatttggcaaagcttttggatcaccatgccaagtgttctgtggttaagtga

Protein Analysis

82

Amino Acids

8.94

Weight (kDa)

8.49

Isoelectric Point (pI)

13.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 100, 225
AfaI GTAC 1 cut(s) 159
AjuI GAANNNNNNNTTGG 4 cut(s) 29, 61, 171, 203
AluBI AGCT 2 cut(s) 83, 211
AluI AGCT 2 cut(s) 83, 211
AlwI GGATC 2 cut(s) 100, 225
ApeKI GCWGC 1 cut(s) 83
AsuHPI GGTGA 1 cut(s) 212
BauI CACGAG 1 cut(s) 24
BbvI GCAGC 1 cut(s) 70
BceAI ACGGC 1 cut(s) 167
BcgI CGANNNNNNTGC 2 cut(s) 75, 109
BfaI CTAG 1 cut(s) 60
BisI GCNGC 1 cut(s) 84
BlsI GCNGC 1 cut(s) 85
BsaJI CCNNGG 2 cut(s) 75, 183
Bse1I ACTGG 1 cut(s) 41
BseDI CCNNGG 2 cut(s) 75, 183
BseGI GGATG 1 cut(s) 145
BseNI ACTGG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 70
Bsp143I GATC 2 cut(s) 92, 217
BspHI TCATGA 1 cut(s) 106
BspPI GGATC 2 cut(s) 100, 225
BsrI ACTGG 1 cut(s) 41
BssECI CCNNGG 2 cut(s) 75, 183
BssMI GATC 2 cut(s) 92, 217
BssSI CACGAG 1 cut(s) 24
BssT1I CCWWGG 1 cut(s) 75
Bst2BI CACGAG 1 cut(s) 24
BstDSI CCRYGG 1 cut(s) 183
BstF5I GGATG 1 cut(s) 145
BstKTI GATC 2 cut(s) 95, 220
BstMBI GATC 2 cut(s) 92, 217
BstV1I GCAGC 1 cut(s) 70
BtgI CCRYGG 1 cut(s) 183
BtsCI GGATG 1 cut(s) 145
BtsI GCAGTG 2 cut(s) 19, 119
BtsIMutI CAGTG 3 cut(s) 19, 48, 119
CciI TCATGA 1 cut(s) 106
Csp6I GTAC 1 cut(s) 158
CviAII CATG 2 cut(s) 107, 224
CviJI RGCY 4 cut(s) 20, 83, 182, 211
CviKI_1 RGCY 4 cut(s) 20, 83, 182, 211
CviQI GTAC 1 cut(s) 158
DpnI GATC 2 cut(s) 94, 219
DpnII GATC 2 cut(s) 92, 217
Eco130I CCWWGG 1 cut(s) 75
EcoT14I CCWWGG 1 cut(s) 75
ErhI CCWWGG 1 cut(s) 75
FaeI CATG 2 cut(s) 110, 227
FaiI YATR 3 cut(s) 100, 108, 225
FatI CATG 2 cut(s) 106, 223
Fnu4HI GCNGC 1 cut(s) 84
FokI GGATG 1 cut(s) 152
Fsp4HI GCNGC 1 cut(s) 84
FspBI CTAG 1 cut(s) 60
GluI GCNGC 1 cut(s) 84
Hin1II CATG 2 cut(s) 110, 227
HindIII AAGCTT 1 cut(s) 209
HphI GGTGA 1 cut(s) 212
Hpy188III TCNNGA 2 cut(s) 107, 164
HpyAV CCTTC 2 cut(s) 113, 139
HpyCH4V TGCA 1 cut(s) 86
Hsp92II CATG 2 cut(s) 110, 227
Kzo9I GATC 2 cut(s) 92, 217
LmnI GCTCC 1 cut(s) 80
LpnPI CCDG 1 cut(s) 54
Lsp1109I GCAGC 1 cut(s) 70
MaeI CTAG 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 116
MalI GATC 2 cut(s) 94, 219
MboI GATC 2 cut(s) 92, 217
MluCI AATT 2 cut(s) 69, 126
MmeI TCCRAC 2 cut(s) 27, 169
MnlI CCTC 1 cut(s) 83
MseI TTAA 1 cut(s) 243
MslI CAYNNNNRTG 1 cut(s) 138
NdeII GATC 2 cut(s) 92, 217
NlaIII CATG 2 cut(s) 110, 227
NmuCI GTSAC 1 cut(s) 116
PagI TCATGA 1 cut(s) 106
PkrI GCNGC 1 cut(s) 85
RsaI GTAC 1 cut(s) 159
RsaNI GTAC 1 cut(s) 158
RseI CAYNNNNRTG 1 cut(s) 138
SaqAI TTAA 1 cut(s) 243
SatI GCNGC 1 cut(s) 84
Sau3AI GATC 2 cut(s) 92, 217
SetI ASST 4 cut(s) 85, 105, 150, 213
SmiMI CAYNNNNRTG 1 cut(s) 138
Sse9I AATT 2 cut(s) 69, 126
SspMI CTAG 1 cut(s) 60
StyI CCWWGG 1 cut(s) 75
TasI AATT 2 cut(s) 69, 126
TatI WGTACW 1 cut(s) 157
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TscAI CASTG 3 cut(s) 19, 48, 119
TseFI GTSAC 1 cut(s) 116
TseI GCWGC 1 cut(s) 83
Tsp45I GTSAC 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 95
TspRI CASTG 3 cut(s) 19, 48, 119
XcmI CCANNNNNNNNNTGG 3 cut(s) 13, 48, 235
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.