Rorug03G0325800
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
35887123 .. 35887471
349 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0325800.1

Sequence Viewer

Length: 258 bp
ATGTACCAAGAAGAGGGGGAGAAAACCTCAAGTGACTATGAGCAGACTAAAGGTGACGATGATATAGATTTTGATGAAAATGTCAAAAATCCAAGCACAATTGAGGAATATGAGGAGATGGGATTTATGGGAGTATGCTCTAATGATGAAGGCAACAGTGATGAGTTTGCTAGTTGGGATGGATCTCAAACAGAAGAGGATGAAGATGGTAATCCTCTTCCCAAGAGATCATCTAAGAATCCAAAAACCAAGGCTTGA

Protein Analysis

85

Amino Acids

9.58

Weight (kDa)

4.05

Isoelectric Point (pI)

58.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 190
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 13
AlwI GGATC 1 cut(s) 190
AsuHPI GGTGA 1 cut(s) 65
BccI CCATC 3 cut(s) 112, 173, 200
BfaI CTAG 1 cut(s) 171
BplI GAGNNNNNCTC 2 cut(s) 11, 43
BpuEI CTTGAG 1 cut(s) 13
BsaBI GATNNNNATC 1 cut(s) 210
BsaJI CCNNGG 1 cut(s) 249
Bsc4I CCNNNNNNNGG 1 cut(s) 13
Bse8I GATNNNNATC 1 cut(s) 210
BseDI CCNNGG 1 cut(s) 249
BseGI GGATG 2 cut(s) 184, 205
BseJI GATNNNNATC 1 cut(s) 210
BseLI CCNNNNNNNGG 1 cut(s) 13
BseRI GAGGAG 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 13
Bsp143I GATC 2 cut(s) 182, 227
BspPI GGATC 1 cut(s) 190
BssECI CCNNGG 1 cut(s) 249
BssMI GATC 2 cut(s) 182, 227
BssT1I CCWWGG 1 cut(s) 249
Bst4CI ACNGT 1 cut(s) 158
Bst6I CTCTTC 3 cut(s) 6, 189, 222
BstDEI CTNAG 1 cut(s) 234
BstF5I GGATG 2 cut(s) 184, 205
BstKTI GATC 2 cut(s) 185, 230
BstMBI GATC 2 cut(s) 182, 227
BstX2I RGATCY 1 cut(s) 182
BstYI RGATCY 1 cut(s) 182
BtsCI GGATG 2 cut(s) 184, 205
BtsIMutI CAGTG 1 cut(s) 163
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 1 cut(s) 254
CviKI_1 RGCY 1 cut(s) 254
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 234
DpnI GATC 2 cut(s) 184, 229
DpnII GATC 2 cut(s) 182, 227
Eam1104I CTCTTC 3 cut(s) 6, 189, 222
EarI CTCTTC 3 cut(s) 6, 189, 222
Eco130I CCWWGG 1 cut(s) 249
EcoT14I CCWWGG 1 cut(s) 249
ErhI CCWWGG 1 cut(s) 249
FaiI YATR 5 cut(s) 39, 65, 111, 128, 136
FokI GGATG 2 cut(s) 191, 212
FspBI CTAG 1 cut(s) 171
HinfI GANTC 1 cut(s) 238
HphI GGTGA 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 158
HpyF3I CTNAG 1 cut(s) 234
Kzo9I GATC 2 cut(s) 182, 227
MaeI CTAG 1 cut(s) 171
MaeIII GTNAC 2 cut(s) 32, 53
MalI GATC 2 cut(s) 184, 229
MboI GATC 2 cut(s) 182, 227
MboII GAAGA 4 cut(s) 23, 206, 209, 215
MfeI CAATTG 1 cut(s) 99
MflI RGATCY 1 cut(s) 182
MluCI AATT 1 cut(s) 99
MnlI CCTC 6 cut(s) 7, 37, 97, 106, 190, 225
MunI CAATTG 1 cut(s) 99
NdeII GATC 2 cut(s) 182, 227
NmuCI GTSAC 2 cut(s) 32, 53
PfeI GAWTC 1 cut(s) 238
PsuI RGATCY 1 cut(s) 182
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
Sau3AI GATC 2 cut(s) 182, 227
SetI ASST 2 cut(s) 29, 55
SgeI CNNG 5 cut(s) 20, 42, 105, 183, 235
SmlI CTYRAG 1 cut(s) 28
SmoI CTYRAG 1 cut(s) 28
Sse9I AATT 1 cut(s) 99
SspMI CTAG 1 cut(s) 171
StyI CCWWGG 1 cut(s) 249
TaaI ACNGT 1 cut(s) 158
TasI AATT 1 cut(s) 99
TfiI GAWTC 1 cut(s) 238
TscAI CASTG 1 cut(s) 163
TseFI GTSAC 2 cut(s) 32, 53
Tsp45I GTSAC 2 cut(s) 32, 53
TspDTI ATGAA 3 cut(s) 90, 162, 216
TspRI CASTG 1 cut(s) 163
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.