RLG00000030637

Ankyrin repeat domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
64745910 .. 64746967
1058 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030637

Sequence Viewer

Length: 438 bp
ATGCTGCATAGGCAAAAACCTGATATGGCTTCTGCCACCTCTAGTAAATGGTTGCCCCTTCACACTCTTGCCGTATCAGTAGAATATTACATTATGCACGCTTTATCAAAACATGAAGCTGATATTAATGCTGCGGATAAGGATGATTGGACTGTTCTTGACAAGGCAATTATCCGTAAAAACCAGGCCATTACAGACTATCTTCTCAGAGATTCGGCTAATCCATTTGATCGTGATAAAGGGGTTGGAAGTTTATGTATTCGGGTGCATCTCCTAAAGTGGAGAAAAGCTTTCTTCGTTTATGATAAAGCAAATATCAGTGACGGATATGCTTGTGCATTTGTTGACGAGGAATTGCAGGCCAGGAGTTTTAGCTTTGGCATGTCGACACCAGATATTGCAGGAATATTAGAGAATTGCAATTCCAAGAATTTTTAG
Functional Annotation

Protein Analysis

146

Amino Acids

16.43

Weight (kDa)

6.5

Isoelectric Point (pI)

32.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 386
AciI CCGC 1 cut(s) 134
AcsI RAATTY 1 cut(s) 430
AjnI CCWGG 2 cut(s) 183, 362
AluBI AGCT 3 cut(s) 119, 290, 375
AluI AGCT 3 cut(s) 119, 290, 375
AoxI GGCC 2 cut(s) 186, 360
ApeKI GCWGC 2 cut(s) 4, 131
ApoI RAATTY 1 cut(s) 430
AseI ATTAAT 1 cut(s) 126
BbvI GCAGC 1 cut(s) 118
BceAI ACGGC 1 cut(s) 56
BciT130I CCWGG 2 cut(s) 185, 364
BfaI CTAG 1 cut(s) 42
BisI GCNGC 2 cut(s) 5, 132
BlsI GCNGC 2 cut(s) 6, 133
Bme1390I CCNGG 2 cut(s) 185, 364
BmrFI CCNGG 2 cut(s) 185, 364
BmsI GCATC 1 cut(s) 277
BseBI CCWGG 2 cut(s) 185, 364
BseGI GGATG 1 cut(s) 148
BseMII CTCAG 1 cut(s) 220
BseXI GCAGC 1 cut(s) 118
BshFI GGCC 2 cut(s) 188, 362
BsnI GGCC 2 cut(s) 188, 362
Bsp143I GATC 1 cut(s) 229
BspACI CCGC 1 cut(s) 134
BspANI GGCC 2 cut(s) 188, 362
BspCNI CTCAG 1 cut(s) 219
BssMI GATC 1 cut(s) 229
Bst2UI CCWGG 2 cut(s) 185, 364
Bst4CI ACNGT 1 cut(s) 154
BstC8I GCNNGC 2 cut(s) 99, 360
BstDEI CTNAG 1 cut(s) 206
BstF5I GGATG 1 cut(s) 148
BstKTI GATC 1 cut(s) 232
BstMBI GATC 1 cut(s) 229
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNI CCWGG 2 cut(s) 185, 364
BstNSI RCATGY 1 cut(s) 385
BstSCI CCNGG 2 cut(s) 183, 362
BstV1I GCAGC 1 cut(s) 118
BsuRI GGCC 2 cut(s) 188, 362
BtsCI GGATG 1 cut(s) 148
BtsIMutI CAGTG 1 cut(s) 325
Cac8I GCNNGC 2 cut(s) 99, 360
CviAII CATG 2 cut(s) 113, 382
CviJI RGCY 7 cut(s) 29, 119, 188, 218, 290, 362, 375
CviKI_1 RGCY 7 cut(s) 29, 119, 188, 218, 290, 362, 375
DdeI CTNAG 1 cut(s) 206
DpnI GATC 1 cut(s) 231
DpnII GATC 1 cut(s) 229
EcoRII CCWGG 2 cut(s) 183, 362
FaeI CATG 2 cut(s) 116, 385
FaiI YATR 8 cut(s) 9, 26, 95, 114, 256, 303, 330, 383
FatI CATG 2 cut(s) 112, 381
FblI GTMKAC 1 cut(s) 386
Fnu4HI GCNGC 2 cut(s) 5, 132
FokI GGATG 1 cut(s) 155
Fsp4HI GCNGC 2 cut(s) 5, 132
FspBI CTAG 1 cut(s) 42
GluI GCNGC 2 cut(s) 5, 132
HaeIII GGCC 2 cut(s) 188, 362
Hin1II CATG 2 cut(s) 116, 385
HincII GTYRAC 2 cut(s) 346, 387
HindII GTYRAC 2 cut(s) 346, 387
HindIII AAGCTT 1 cut(s) 288
HinfI GANTC 1 cut(s) 212
Hpy166II GTNNAC 2 cut(s) 346, 387
Hpy188I TCNGA 1 cut(s) 209
Hpy188III TCNNGA 2 cut(s) 158, 233
Hpy8I GTNNAC 2 cut(s) 346, 387
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 7 cut(s) 7, 97, 268, 338, 358, 401, 420
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 206
Hsp92II CATG 2 cut(s) 116, 385
Kzo9I GATC 1 cut(s) 229
LpnPI CCDG 8 cut(s) 33, 170, 197, 344, 349, 376, 387, 405
Lsp1109I GCAGC 1 cut(s) 118
LweI GCATC 1 cut(s) 277
MaeI CTAG 1 cut(s) 42
MaeIII GTNAC 1 cut(s) 320
MalI GATC 1 cut(s) 231
MboI GATC 1 cut(s) 229
MboII GAAGA 2 cut(s) 194, 286
MluCI AATT 5 cut(s) 168, 353, 415, 421, 430
MmeI TCCRAC 1 cut(s) 226
MnlI CCTC 2 cut(s) 49, 343
MseI TTAA 1 cut(s) 126
MspR9I CCNGG 2 cut(s) 185, 364
MvaI CCWGG 2 cut(s) 185, 364
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 1 cut(s) 229
NlaIII CATG 2 cut(s) 116, 385
NmuCI GTSAC 1 cut(s) 320
NspI RCATGY 1 cut(s) 385
PfeI GAWTC 1 cut(s) 212
PkrI GCNGC 2 cut(s) 6, 133
PshBI ATTAAT 1 cut(s) 126
Psp6I CCWGG 2 cut(s) 183, 362
PspGI CCWGG 2 cut(s) 183, 362
SalI GTCGAC 1 cut(s) 385
SaqAI TTAA 1 cut(s) 126
SatI GCNGC 2 cut(s) 5, 132
Sau3AI GATC 1 cut(s) 229
ScrFI CCNGG 2 cut(s) 185, 364
SetI ASST 5 cut(s) 22, 41, 121, 292, 377
SfaNI GCATC 1 cut(s) 277
Sse9I AATT 5 cut(s) 168, 353, 415, 421, 430
SsiI CCGC 1 cut(s) 134
SspI AATATT 2 cut(s) 86, 408
SspMI CTAG 1 cut(s) 42
StyD4I CCNGG 2 cut(s) 183, 362
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 1 cut(s) 386
TasI AATT 5 cut(s) 168, 353, 415, 421, 430
TfiI GAWTC 1 cut(s) 212
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 1 cut(s) 325
TseFI GTSAC 1 cut(s) 320
TseI GCWGC 2 cut(s) 4, 131
Tsp45I GTSAC 1 cut(s) 320
TspDTI ATGAA 1 cut(s) 129
TspGWI ACGGA 2 cut(s) 164, 339
TspRI CASTG 1 cut(s) 325
VspI ATTAAT 1 cut(s) 126
XapI RAATTY 1 cut(s) 430
XceI RCATGY 1 cut(s) 385
XmiI GTMKAC 1 cut(s) 386
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.