Rmu_co8173478.1_g000001

Ankyrin repeat domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8173478.1
Physical Location & Seq
Forward (+)
1 .. 634
634 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8173478.1_g000001.1.cds

Sequence Viewer

Length: 276 bp
ctgatgctgaataggcgaaaacctgatatagctgctgccacttctagtaaatggcttccccttcacactcttgccgcatcaggagaatattaccttatggacgctttattgaaacatgaagctgatatcaatgctgtggataaggatgattggactgttcttcacaaagcaatcattggtaaaaaccaggccattacaaactatcttctcagagaatcggctaatccatttgttcgtgataaagtgagtagaagtttatgtaggtatatctattga
Functional Annotation

Protein Analysis

91

Amino Acids

10.4

Weight (kDa)

9.13

Isoelectric Point (pI)

23.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 75
AgsI TTSAA 1 cut(s) 112
AjnI CCWGG 1 cut(s) 186
AluBI AGCT 2 cut(s) 32, 122
AluI AGCT 2 cut(s) 32, 122
AoxI GGCC 1 cut(s) 189
ApeKI GCWGC 2 cut(s) 32, 35
BbvI GCAGC 2 cut(s) 19, 22
BciT130I CCWGG 1 cut(s) 188
BfaI CTAG 1 cut(s) 45
BisI GCNGC 3 cut(s) 33, 36, 75
BlsI GCNGC 3 cut(s) 34, 37, 76
Bme1390I CCNGG 1 cut(s) 188
BmrFI CCNGG 1 cut(s) 188
BmsI GCATC 1 cut(s) 86
BseBI CCWGG 1 cut(s) 188
BseGI GGATG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 223
BseXI GCAGC 2 cut(s) 19, 22
BshFI GGCC 1 cut(s) 191
BsnI GGCC 1 cut(s) 191
BspACI CCGC 1 cut(s) 75
BspANI GGCC 1 cut(s) 191
BspCNI CTCAG 1 cut(s) 222
Bst2UI CCWGG 1 cut(s) 188
Bst4CI ACNGT 1 cut(s) 157
BstDEI CTNAG 1 cut(s) 209
BstF5I GGATG 1 cut(s) 151
BstMWI GCNNNNNNNGC 1 cut(s) 13
BstNI CCWGG 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 186
BstV1I GCAGC 2 cut(s) 19, 22
BsuRI GGCC 1 cut(s) 191
BtsCI GGATG 1 cut(s) 151
CseI GACGC 1 cut(s) 110
CviAII CATG 1 cut(s) 116
CviJI RGCY 5 cut(s) 32, 55, 122, 191, 221
CviKI_1 RGCY 5 cut(s) 32, 55, 122, 191, 221
DdeI CTNAG 1 cut(s) 209
Eco32I GATATC 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 186
EcoRV GATATC 1 cut(s) 127
FaeI CATG 1 cut(s) 119
FaiI YATR 5 cut(s) 29, 98, 117, 259, 267
FatI CATG 1 cut(s) 115
Fnu4HI GCNGC 3 cut(s) 33, 36, 75
FokI GGATG 1 cut(s) 158
Fsp4HI GCNGC 3 cut(s) 33, 36, 75
FspBI CTAG 1 cut(s) 45
GluI GCNGC 3 cut(s) 33, 36, 75
HaeIII GGCC 1 cut(s) 191
HgaI GACGC 1 cut(s) 110
Hin1II CATG 1 cut(s) 119
HinfI GANTC 1 cut(s) 215
Hpy188I TCNGA 1 cut(s) 212
Hpy188III TCNNGA 2 cut(s) 81, 236
HpyAV CCTTC 1 cut(s) 71
HpyCH4III ACNGT 1 cut(s) 157
HpyF10VI GCNNNNNNNGC 1 cut(s) 13
HpyF3I CTNAG 1 cut(s) 209
Hsp92II CATG 1 cut(s) 119
LpnPI CCDG 4 cut(s) 36, 66, 173, 200
Lsp1109I GCAGC 2 cut(s) 19, 22
LweI GCATC 1 cut(s) 86
MaeI CTAG 1 cut(s) 45
MboII GAAGA 2 cut(s) 152, 197
MspR9I CCNGG 1 cut(s) 188
MvaI CCWGG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 13
NlaIII CATG 1 cut(s) 119
PfeI GAWTC 1 cut(s) 215
PkrI GCNGC 3 cut(s) 34, 37, 76
Psp6I CCWGG 1 cut(s) 186
PspGI CCWGG 1 cut(s) 186
SatI GCNGC 3 cut(s) 33, 36, 75
ScrFI CCNGG 1 cut(s) 188
SetI ASST 5 cut(s) 25, 34, 96, 124, 266
SfaNI GCATC 1 cut(s) 86
SgeI CNNG 8 cut(s) 35, 57, 83, 93, 128, 199, 200, 248
SsiI CCGC 1 cut(s) 75
SspI AATATT 1 cut(s) 89
SspMI CTAG 1 cut(s) 45
StyD4I CCNGG 1 cut(s) 186
TaaI ACNGT 1 cut(s) 157
TauI GCSGC 1 cut(s) 77
TfiI GAWTC 1 cut(s) 215
TseI GCWGC 2 cut(s) 32, 35
TspDTI ATGAA 1 cut(s) 132
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.