Rmu_co8250551.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8250551.1
OG0001112
Physical Location & Seq
Reverse (-)
2 .. 608
607 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8250551.1_g000001.1.cds

Sequence Viewer

Length: 511 bp
atgggagtttatatggctgatgaagacatagtagtcttggttcttcatggtttcccctcagagtttgctaccataaaaacttctatttctgagaggttcaggaatgaaatgatggcacatggtgatagtttcaaaaggacatgtgacattaatgctgctgatggctctgaatcaggaaaagtggaatgtagagaaactgaatcttgtgggatagaatctaggaaaattaacatggacatgcaggttatgcgaggattgagcccgggttctgataatatgtgtgaaaaagttgaacattgtgtgattgaaaatattttgagacaatcttcagtggggtcaaagacgagaacttctggatctgaactttttcttggtgattctgaagcttcatcaaacagaactacaaaagcaattgagggctgcacaataaggaagcatactagtgatagctttgatggtcgtaatggcaaagatcctgtcaaagttgatagatcaatgacatctgacaccg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

170

Amino Acids

18.67

Weight (kDa)

5.28

Isoelectric Point (pI)

52.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 32
Acc36I ACCTGC 1 cut(s) 232
AclWI GGATC 2 cut(s) 364, 467
AcuI CTGAAG 2 cut(s) 312, 402
AdeI CACNNNGTG 1 cut(s) 122
AflIII ACRYGT 1 cut(s) 140
AgsI TTSAA 3 cut(s) 133, 293, 308
AhlI ACTAGT 1 cut(s) 440
AjuI GAANNNNNNNTTGG 2 cut(s) 354, 386
AluBI AGCT 2 cut(s) 386, 450
AluI AGCT 2 cut(s) 386, 450
Alw26I GTCTC 1 cut(s) 313
AlwI GGATC 2 cut(s) 364, 467
Ama87I CYCGRG 1 cut(s) 262
ApeKI GCWGC 2 cut(s) 155, 420
ArsI GACNNNNNNTTYG 2 cut(s) 462, 494
AseI ATTAAT 1 cut(s) 150
Asp700I GAANNNNTTC 1 cut(s) 366
AsuC2I CCSGG 2 cut(s) 263, 264
AsuHPI GGTGA 2 cut(s) 134, 386
AvaI CYCGRG 1 cut(s) 262
BanII GRGCYC 1 cut(s) 263
BbsI GAAGAC 1 cut(s) 30
BbvI GCAGC 2 cut(s) 142, 407
BccI CCATC 3 cut(s) 106, 155, 449
BcnI CCSGG 2 cut(s) 263, 264
BcoDI GTCTC 1 cut(s) 313
BcuI ACTAGT 1 cut(s) 440
BfaI CTAG 2 cut(s) 219, 441
BfuAI ACCTGC 1 cut(s) 232
BisI GCNGC 2 cut(s) 156, 421
BlsI GCNGC 2 cut(s) 157, 422
Bme1390I CCNGG 2 cut(s) 263, 264
BmeT110I CYCGRG 1 cut(s) 262
BmrFI CCNGG 2 cut(s) 263, 264
BpiI GAAGAC 1 cut(s) 30
BpuMI CCSGG 2 cut(s) 263, 264
BsaJI CCNNGG 1 cut(s) 262
BseDI CCNNGG 1 cut(s) 262
BseMII CTCAG 2 cut(s) 72, 81
BseXI GCAGC 2 cut(s) 142, 407
BsgI GTGCAG 1 cut(s) 406
BsiHKCI CYCGRG 1 cut(s) 262
BsiSI CCGG 1 cut(s) 263
BsmAI GTCTC 1 cut(s) 313
BsoBI CYCGRG 1 cut(s) 262
Bsp1286I GDGCHC 1 cut(s) 263
Bsp143I GATC 3 cut(s) 356, 472, 491
BspCNI CTCAG 2 cut(s) 71, 82
BspMI ACCTGC 1 cut(s) 232
BspPI GGATC 2 cut(s) 364, 467
BssECI CCNNGG 1 cut(s) 262
BssMI GATC 3 cut(s) 356, 472, 491
BstAPI GCANNNNNTGC 1 cut(s) 247
BstDEI CTNAG 2 cut(s) 58, 90
BstKTI GATC 3 cut(s) 359, 475, 494
BstMAI GTCTC 1 cut(s) 313
BstMBI GATC 3 cut(s) 356, 472, 491
BstMWI GCNNNNNNNGC 1 cut(s) 247
BstNSI RCATGY 2 cut(s) 144, 241
BstSCI CCNGG 2 cut(s) 261, 262
BstV1I GCAGC 2 cut(s) 142, 407
BstV2I GAAGAC 1 cut(s) 30
BstX2I RGATCY 2 cut(s) 356, 472
BstYI RGATCY 2 cut(s) 356, 472
BtsIMutI CAGTG 1 cut(s) 336
BveI ACCTGC 1 cut(s) 232
Cfr9I CCCGGG 1 cut(s) 262
CviAII CATG 5 cut(s) 47, 119, 141, 232, 238
CviJI RGCY 6 cut(s) 17, 165, 261, 386, 420, 450
CviKI_1 RGCY 6 cut(s) 17, 165, 261, 386, 420, 450
DdeI CTNAG 2 cut(s) 58, 90
DpnI GATC 3 cut(s) 358, 474, 493
DpnII GATC 3 cut(s) 356, 472, 491
DraIII CACNNNGTG 1 cut(s) 122
DrdI GACNNNNNNGTC 1 cut(s) 32
DseDI GACNNNNNNGTC 1 cut(s) 32
Eco24I GRGCYC 1 cut(s) 263
Eco57I CTGAAG 2 cut(s) 312, 402
Eco88I CYCGRG 1 cut(s) 262
EcoT38I GRGCYC 1 cut(s) 263
FaeI CATG 5 cut(s) 50, 122, 144, 235, 241
FatI CATG 5 cut(s) 46, 118, 140, 231, 237
Fnu4HI GCNGC 2 cut(s) 156, 421
FriOI GRGCYC 1 cut(s) 263
Fsp4HI GCNGC 2 cut(s) 156, 421
FspBI CTAG 2 cut(s) 219, 441
GluI GCNGC 2 cut(s) 156, 421
HapII CCGG 1 cut(s) 263
Hin1II CATG 5 cut(s) 50, 122, 144, 235, 241
HindIII AAGCTT 1 cut(s) 384
HinfI GANTC 4 cut(s) 170, 200, 215, 377
HpaII CCGG 1 cut(s) 263
HphI GGTGA 2 cut(s) 134, 386
Hpy188I TCNGA 7 cut(s) 61, 91, 169, 271, 361, 382, 505
Hpy188III TCNNGA 3 cut(s) 100, 174, 354
HpyCH4V TGCA 2 cut(s) 241, 423
HpyF10VI GCNNNNNNNGC 1 cut(s) 247
HpyF3I CTNAG 2 cut(s) 58, 90
Hsp92II CATG 5 cut(s) 50, 122, 144, 235, 241
Kzo9I GATC 3 cut(s) 356, 472, 491
LpnPI CCDG 6 cut(s) 85, 159, 227, 276, 339, 489
Lsp1109I GCAGC 2 cut(s) 142, 407
MaeI CTAG 2 cut(s) 219, 441
MaeIII GTNAC 1 cut(s) 143
MalI GATC 3 cut(s) 358, 474, 493
MboI GATC 3 cut(s) 356, 472, 491
MboII GAAGA 3 cut(s) 35, 35, 318
MfeI CAATTG 1 cut(s) 411
MflI RGATCY 2 cut(s) 356, 472
MhlI GDGCHC 1 cut(s) 263
MluCI AATT 2 cut(s) 225, 411
MnlI CCTC 4 cut(s) 67, 87, 245, 409
MroXI GAANNNNTTC 1 cut(s) 366
MseI TTAA 2 cut(s) 150, 228
MslI CAYNNNNRTG 2 cut(s) 236, 441
MspI CCGG 1 cut(s) 263
MspR9I CCNGG 2 cut(s) 263, 264
MunI CAATTG 1 cut(s) 411
MwoI GCNNNNNNNGC 1 cut(s) 247
NciI CCSGG 2 cut(s) 263, 264
NdeII GATC 3 cut(s) 356, 472, 491
NlaIII CATG 5 cut(s) 50, 122, 144, 235, 241
NmuCI GTSAC 1 cut(s) 143
NspI RCATGY 2 cut(s) 144, 241
PciI ACATGT 1 cut(s) 140
PdmI GAANNNNTTC 1 cut(s) 366
PfeI GAWTC 4 cut(s) 170, 200, 215, 377
PkrI GCNGC 2 cut(s) 157, 422
PscI ACATGT 1 cut(s) 140
PshBI ATTAAT 1 cut(s) 150
PsrI GAACNNNNNNTAC 2 cut(s) 24, 56
PsuI RGATCY 2 cut(s) 356, 472
RseI CAYNNNNRTG 2 cut(s) 236, 441
SaqAI TTAA 2 cut(s) 150, 228
SatI GCNGC 2 cut(s) 156, 421
Sau3AI GATC 3 cut(s) 356, 472, 491
ScrFI CCNGG 2 cut(s) 263, 264
SduI GDGCHC 1 cut(s) 263
SetI ASST 4 cut(s) 98, 246, 388, 452
SmaI CCCGGG 1 cut(s) 264
SmiMI CAYNNNNRTG 2 cut(s) 236, 441
SpeI ACTAGT 1 cut(s) 440
Sse9I AATT 2 cut(s) 225, 411
SspI AATATT 1 cut(s) 313
SspMI CTAG 2 cut(s) 219, 441
StyD4I CCNGG 2 cut(s) 261, 262
TasI AATT 2 cut(s) 225, 411
TfiI GAWTC 4 cut(s) 170, 200, 215, 377
Tru1I TTAA 2 cut(s) 150, 228
Tru9I TTAA 2 cut(s) 150, 228
TscAI CASTG 1 cut(s) 336
TseFI GTSAC 1 cut(s) 143
TseI GCWGC 2 cut(s) 155, 420
Tsp45I GTSAC 1 cut(s) 143
TspDTI ATGAA 4 cut(s) 35, 36, 120, 378
TspMI CCCGGG 1 cut(s) 262
TspRI CASTG 1 cut(s) 336
VspI ATTAAT 1 cut(s) 150
XceI RCATGY 2 cut(s) 144, 241
XmaI CCCGGG 1 cut(s) 262
XmnI GAANNNNTTC 1 cut(s) 366
XspI CTAG 2 cut(s) 219, 441
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.