Rmu_ssc0000116.1_g000016

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000116.1
Physical Location & Seq
Forward (+)
94469 .. 95609
1141 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000116.1_g000016.1.cds

Sequence Viewer

Length: 507 bp
atgccgggagaggtggtggagatgggtctccaagaacatgatgtggtgatagtcaccttcttctccttgctccaagctcttgatattgatctggcatgtgacactgaagatggagagttgagggaatcatatgtgccttattgggaggagaatgattttgaagaaattgaacttgttgattatggttctaatacatgtggcactaatgttgctgatggaaaagtggaatgcagagaaactgaattttgtgggatagaatctaggaacattaacatgaacgtgcaggttgggcgaggattaagcctaggttacgatattatgtgtggaaaagttgaacattgtgcaattggaaatgctttgagacaatcttcagtgggttcaaagacgagaacttctggaactgagcaattgctcggagatatatgcactacttggaaccatgttggtggtaaaatacatatgcactacttggaagagcttcttttcttggaggttcaatgtgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

168

Amino Acids

18.73

Weight (kDa)

4.33

Isoelectric Point (pI)

51.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 274
AcsI RAATTY 1 cut(s) 242
AcuI CTGAAG 2 cut(s) 126, 354
AflIII ACRYGT 1 cut(s) 194
AgsI TTSAA 5 cut(s) 161, 170, 335, 381, 497
AluBI AGCT 2 cut(s) 77, 478
AluI AGCT 2 cut(s) 77, 478
Alw26I GTCTC 2 cut(s) 32, 355
ApoI RAATTY 1 cut(s) 242
Asp700I GAANNNNTTC 1 cut(s) 477
AspA2I CCTAGG 1 cut(s) 304
AsuC2I CCSGG 1 cut(s) 6
AsuHPI GGTGA 2 cut(s) 46, 58
AvrII CCTAGG 1 cut(s) 304
BccI CCATC 3 cut(s) 16, 104, 209
BcnI CCSGG 1 cut(s) 6
BcoDI GTCTC 2 cut(s) 32, 355
BfaI CTAG 2 cut(s) 261, 305
BfuAI ACCTGC 1 cut(s) 274
BlnI CCTAGG 1 cut(s) 304
Bme1390I CCNGG 1 cut(s) 6
BmiI GGNNCC 1 cut(s) 437
BmrFI CCNGG 1 cut(s) 6
BpuMI CCSGG 1 cut(s) 6
BsaBI GATNNNNATC 1 cut(s) 87
BsaI GGTCTC 1 cut(s) 32
BsaJI CCNNGG 1 cut(s) 304
BsaXI ACNNNNNCTCC 1 cut(s) 30
Bse8I GATNNNNATC 1 cut(s) 87
BseDI CCNNGG 1 cut(s) 304
BseJI GATNNNNATC 1 cut(s) 87
BseMII CTCAG 1 cut(s) 393
BseRI GAGGAG 1 cut(s) 161
BsgI GTGCAG 1 cut(s) 302
BsiSI CCGG 1 cut(s) 5
BsmAI GTCTC 2 cut(s) 32, 355
BsmI GAATGC 1 cut(s) 233
Bso31I GGTCTC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 88
BspCNI CTCAG 1 cut(s) 394
BspLI GGNNCC 1 cut(s) 437
BspMI ACCTGC 1 cut(s) 274
BspQI GCTCTTC 1 cut(s) 468
BspTNI GGTCTC 1 cut(s) 32
BssECI CCNNGG 1 cut(s) 304
BssMI GATC 1 cut(s) 88
BssT1I CCWWGG 1 cut(s) 304
Bst6I CTCTTC 1 cut(s) 468
BstDEI CTNAG 1 cut(s) 402
BstKTI GATC 1 cut(s) 91
BstMAI GTCTC 2 cut(s) 32, 355
BstMBI GATC 1 cut(s) 88
BstMWI GCNNNNNNNGC 1 cut(s) 289
BstNSI RCATGY 2 cut(s) 99, 198
BstSCI CCNGG 1 cut(s) 4
BstXI CCANNNNNNTGG 1 cut(s) 446
BtsIMutI CAGTG 2 cut(s) 102, 378
BveI ACCTGC 1 cut(s) 274
CviAII CATG 5 cut(s) 38, 96, 195, 274, 440
CviJI RGCY 3 cut(s) 77, 303, 478
CviKI_1 RGCY 3 cut(s) 77, 303, 478
DdeI CTNAG 1 cut(s) 402
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
Eam1104I CTCTTC 1 cut(s) 468
EarI CTCTTC 1 cut(s) 468
Eco130I CCWWGG 1 cut(s) 304
Eco31I GGTCTC 1 cut(s) 32
Eco57I CTGAAG 2 cut(s) 126, 354
EcoT14I CCWWGG 1 cut(s) 304
ErhI CCWWGG 1 cut(s) 304
FaeI CATG 5 cut(s) 41, 99, 198, 277, 443
FalI AAGNNNNNCTT 2 cut(s) 465, 497
FatI CATG 5 cut(s) 37, 95, 194, 273, 439
FauNDI CATATG 2 cut(s) 130, 459
FspBI CTAG 2 cut(s) 261, 305
HapII CCGG 1 cut(s) 5
Hin1II CATG 5 cut(s) 41, 99, 198, 277, 443
HinfI GANTC 2 cut(s) 125, 257
HpaII CCGG 1 cut(s) 5
HphI GGTGA 2 cut(s) 46, 58
Hpy188I TCNGA 1 cut(s) 416
Hpy188III TCNNGA 2 cut(s) 80, 396
HpyAV CCTTC 1 cut(s) 67
HpyCH4IV ACGT 1 cut(s) 279
HpyCH4V TGCA 5 cut(s) 231, 283, 344, 426, 463
HpyF10VI GCNNNNNNNGC 1 cut(s) 289
HpyF3I CTNAG 1 cut(s) 402
HpySE526I ACGT 1 cut(s) 279
Hsp92II CATG 5 cut(s) 41, 99, 198, 277, 443
Kzo9I GATC 1 cut(s) 88
LguI GCTCTTC 1 cut(s) 468
LmnI GCTCC 1 cut(s) 75
LpnPI CCDG 4 cut(s) 18, 77, 269, 381
MaeI CTAG 2 cut(s) 261, 305
MaeII ACGT 1 cut(s) 279
MaeIII GTNAC 3 cut(s) 52, 98, 308
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 5 cut(s) 52, 119, 173, 360, 485
MfeI CAATTG 2 cut(s) 345, 407
MluCI AATT 4 cut(s) 165, 242, 345, 407
MnlI CCTC 5 cut(s) 4, 114, 139, 287, 484
MroXI GAANNNNTTC 1 cut(s) 477
MseI TTAA 2 cut(s) 270, 299
MslI CAYNNNNRTG 3 cut(s) 272, 278, 444
MspI CCGG 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 6
MunI CAATTG 2 cut(s) 345, 407
Mva1269I GAATGC 1 cut(s) 233
MwoI GCNNNNNNNGC 1 cut(s) 289
NciI CCSGG 1 cut(s) 6
NdeI CATATG 2 cut(s) 130, 459
NdeII GATC 1 cut(s) 88
NlaIII CATG 5 cut(s) 41, 99, 198, 277, 443
NlaIV GGNNCC 1 cut(s) 437
NmuCI GTSAC 2 cut(s) 52, 98
NspI RCATGY 2 cut(s) 99, 198
PciI ACATGT 1 cut(s) 194
PciSI GCTCTTC 1 cut(s) 468
PctI GAATGC 1 cut(s) 233
PdmI GAANNNNTTC 1 cut(s) 477
PfeI GAWTC 2 cut(s) 125, 257
PscI ACATGT 1 cut(s) 194
PspN4I GGNNCC 1 cut(s) 437
RseI CAYNNNNRTG 3 cut(s) 272, 278, 444
SapI GCTCTTC 1 cut(s) 468
SaqAI TTAA 2 cut(s) 270, 299
Sau3AI GATC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 6
SetI ASST 8 cut(s) 15, 59, 79, 282, 288, 310, 480, 495
SmiMI CAYNNNNRTG 3 cut(s) 272, 278, 444
Sse9I AATT 4 cut(s) 165, 242, 345, 407
SspMI CTAG 2 cut(s) 261, 305
StyD4I CCNGG 1 cut(s) 4
StyI CCWWGG 1 cut(s) 304
TaiI ACGT 1 cut(s) 282
TasI AATT 4 cut(s) 165, 242, 345, 407
TfiI GAWTC 2 cut(s) 125, 257
Tru1I TTAA 2 cut(s) 270, 299
Tru9I TTAA 2 cut(s) 270, 299
TscAI CASTG 2 cut(s) 109, 378
TseFI GTSAC 2 cut(s) 52, 98
Tsp45I GTSAC 2 cut(s) 52, 98
TspDTI ATGAA 1 cut(s) 290
TspRI CASTG 2 cut(s) 109, 378
XapI RAATTY 1 cut(s) 242
XceI RCATGY 2 cut(s) 99, 198
XmaJI CCTAGG 1 cut(s) 304
XmnI GAANNNNTTC 1 cut(s) 477
XspI CTAG 2 cut(s) 261, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.