Rmu_sc0027363.1_g000004

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027363.1
Physical Location & Seq
Reverse (-)
9388 .. 9948
561 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027363.1_g000004.1.cds

Sequence Viewer

Length: 561 bp
atggcaactggcaatgtttgcagcattcagaattataacaatgatactggtctcgaggaggttgaagttggtgaaggaaaagaagaacagacttgtttagctcaagaaactcaaaagacttcaaggcatgaaagagatcttcacatgcatagtgatttagaaaatgtatgcgctaagaaggtagaggtttccgggagctgcttagaggtaatagatatggcatgtgacactgaagatggagagttgagggaatcagatgtgccttattgggaggagaatgattttgaagaaattgaacatgttgattatggttctgatacatatgacactaatgctgctaatggaaaaatggaatgtagagaaactgaattttgtgggatagaatctaggaacattaacatcaacgtgcaggttgggcgaggattaagcctaggttacgatattatgtgtggaaaagttgaacattgtgcaattggaaatgctttgagacaatcttcagtgggttcaaagacgagaacttctggagctgaacaattgcccggagatatatgcactacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

186

Amino Acids

20.51

Weight (kDa)

4.36

Isoelectric Point (pI)

51.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 36
Acc36I ACCTGC 1 cut(s) 400
AcsI RAATTY 1 cut(s) 368
AcuI CTGAAG 2 cut(s) 252, 480
AflIII ACRYGT 1 cut(s) 298
AgsI TTSAA 6 cut(s) 65, 123, 287, 296, 461, 507
AluBI AGCT 3 cut(s) 101, 198, 527
AluI AGCT 3 cut(s) 101, 198, 527
Alw26I GTCTC 2 cut(s) 56, 481
Ama87I CYCGRG 1 cut(s) 53
ApeKI GCWGC 3 cut(s) 21, 198, 335
ApoI RAATTY 1 cut(s) 368
AspA2I CCTAGG 1 cut(s) 430
AspLEI GCGC 1 cut(s) 173
AsuC2I CCSGG 2 cut(s) 193, 540
AsuHPI GGTGA 1 cut(s) 83
AvaI CYCGRG 1 cut(s) 53
AvrII CCTAGG 1 cut(s) 430
BbvI GCAGC 3 cut(s) 33, 185, 322
BccI CCATC 1 cut(s) 230
BcnI CCSGG 2 cut(s) 193, 540
BcoDI GTCTC 2 cut(s) 56, 481
BfaI CTAG 2 cut(s) 387, 431
BfuAI ACCTGC 1 cut(s) 400
BglII AGATCT 1 cut(s) 136
BisI GCNGC 3 cut(s) 22, 199, 336
BlnI CCTAGG 1 cut(s) 430
BlsI GCNGC 3 cut(s) 23, 200, 337
Bme1390I CCNGG 2 cut(s) 193, 540
BmeT110I CYCGRG 1 cut(s) 53
BmrFI CCNGG 2 cut(s) 193, 540
BpmI CTGGAG 1 cut(s) 543
BpuEI CTTGAG 1 cut(s) 87
BpuMI CCSGG 2 cut(s) 193, 540
BsaI GGTCTC 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 430
Bse1I ACTGG 2 cut(s) 13, 52
Bse3DI GCAATG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 430
BseMI GCAATG 1 cut(s) 19
BseNI ACTGG 2 cut(s) 13, 52
BseRI GAGGAG 2 cut(s) 71, 287
BseXI GCAGC 3 cut(s) 33, 185, 322
BsgI GTGCAG 1 cut(s) 428
BsiHKCI CYCGRG 1 cut(s) 53
BsiSI CCGG 2 cut(s) 192, 540
BsmAI GTCTC 2 cut(s) 56, 481
BsmI GAATGC 1 cut(s) 24
Bso31I GGTCTC 1 cut(s) 56
BsoBI CYCGRG 1 cut(s) 53
Bsp143I GATC 1 cut(s) 136
BspMI ACCTGC 1 cut(s) 400
BspTNI GGTCTC 1 cut(s) 56
BsrDI GCAATG 1 cut(s) 19
BsrI ACTGG 2 cut(s) 13, 52
BssECI CCNNGG 1 cut(s) 430
BssMI GATC 1 cut(s) 136
BssT1I CCWWGG 1 cut(s) 430
BstAPI GCANNNNNTGC 1 cut(s) 18
BstDEI CTNAG 3 cut(s) 174, 202, 558
BstHHI GCGC 1 cut(s) 173
BstKTI GATC 1 cut(s) 139
BstMAI GTCTC 2 cut(s) 56, 481
BstMBI GATC 1 cut(s) 136
BstMWI GCNNNNNNNGC 2 cut(s) 18, 415
BstNSI RCATGY 3 cut(s) 148, 225, 302
BstSCI CCNGG 2 cut(s) 191, 538
BstV1I GCAGC 3 cut(s) 33, 185, 322
BstX2I RGATCY 1 cut(s) 136
BstYI RGATCY 1 cut(s) 136
BtsIMutI CAGTG 2 cut(s) 228, 504
BveI ACCTGC 1 cut(s) 400
CfoI GCGC 1 cut(s) 173
CviAII CATG 4 cut(s) 128, 145, 222, 299
CviJI RGCY 4 cut(s) 101, 198, 429, 527
CviKI_1 RGCY 4 cut(s) 101, 198, 429, 527
DdeI CTNAG 3 cut(s) 174, 202, 558
DpnI GATC 1 cut(s) 138
DpnII GATC 1 cut(s) 136
Eco130I CCWWGG 1 cut(s) 430
Eco31I GGTCTC 1 cut(s) 56
Eco57I CTGAAG 2 cut(s) 252, 480
Eco88I CYCGRG 1 cut(s) 53
EcoT14I CCWWGG 1 cut(s) 430
EcoT22I ATGCAT 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 430
FaeI CATG 4 cut(s) 131, 148, 225, 302
FatI CATG 4 cut(s) 127, 144, 221, 298
FauNDI CATATG 1 cut(s) 322
Fnu4HI GCNGC 3 cut(s) 22, 199, 336
Fsp4HI GCNGC 3 cut(s) 22, 199, 336
FspBI CTAG 2 cut(s) 387, 431
GlaI GCGC 1 cut(s) 172
GluI GCNGC 3 cut(s) 22, 199, 336
GsuI CTGGAG 1 cut(s) 543
HapII CCGG 2 cut(s) 192, 540
HhaI GCGC 1 cut(s) 173
Hin1II CATG 4 cut(s) 131, 148, 225, 302
Hin6I GCGC 1 cut(s) 171
HinP1I GCGC 1 cut(s) 171
HinfI GANTC 2 cut(s) 251, 383
HpaII CCGG 2 cut(s) 192, 540
HphI GGTGA 1 cut(s) 83
Hpy188I TCNGA 3 cut(s) 30, 256, 316
Hpy188III TCNNGA 3 cut(s) 53, 104, 522
HpyAV CCTTC 2 cut(s) 68, 172
HpyCH4IV ACGT 1 cut(s) 405
HpyCH4V TGCA 5 cut(s) 21, 148, 409, 470, 552
HpyF10VI GCNNNNNNNGC 2 cut(s) 18, 415
HpyF3I CTNAG 3 cut(s) 174, 202, 558
HpySE526I ACGT 1 cut(s) 405
Hsp92II CATG 4 cut(s) 131, 148, 225, 302
HspAI GCGC 1 cut(s) 171
Kzo9I GATC 1 cut(s) 136
LmnI GCTCC 2 cut(s) 195, 524
LpnPI CCDG 5 cut(s) 33, 205, 395, 507, 553
Lsp1109I GCAGC 3 cut(s) 33, 185, 322
MaeI CTAG 2 cut(s) 387, 431
MaeII ACGT 1 cut(s) 405
MaeIII GTNAC 2 cut(s) 224, 434
MalI GATC 1 cut(s) 138
MboI GATC 1 cut(s) 136
MboII GAAGA 5 cut(s) 95, 131, 245, 299, 486
MfeI CAATTG 2 cut(s) 471, 533
MflI RGATCY 1 cut(s) 136
MluCI AATT 5 cut(s) 31, 291, 368, 471, 533
MnlI CCTC 7 cut(s) 49, 52, 178, 199, 240, 265, 413
Mph1103I ATGCAT 1 cut(s) 150
MseI TTAA 2 cut(s) 396, 425
MslI CAYNNNNRTG 1 cut(s) 404
MspI CCGG 2 cut(s) 192, 540
MspR9I CCNGG 2 cut(s) 193, 540
MunI CAATTG 2 cut(s) 471, 533
Mva1269I GAATGC 1 cut(s) 24
MwoI GCNNNNNNNGC 2 cut(s) 18, 415
NciI CCSGG 2 cut(s) 193, 540
NdeI CATATG 1 cut(s) 322
NdeII GATC 1 cut(s) 136
NlaIII CATG 4 cut(s) 131, 148, 225, 302
NmuCI GTSAC 1 cut(s) 224
NsiI ATGCAT 1 cut(s) 150
NspI RCATGY 3 cut(s) 148, 225, 302
PaeR7I CTCGAG 1 cut(s) 53
PciI ACATGT 1 cut(s) 298
PctI GAATGC 1 cut(s) 24
PfeI GAWTC 2 cut(s) 251, 383
PfoI TCCNGGA 1 cut(s) 191
PkrI GCNGC 3 cut(s) 23, 200, 337
PscI ACATGT 1 cut(s) 298
PsiI TTATAA 1 cut(s) 36
PsuI RGATCY 1 cut(s) 136
RseI CAYNNNNRTG 1 cut(s) 404
SaqAI TTAA 2 cut(s) 396, 425
SatI GCNGC 3 cut(s) 22, 199, 336
Sau3AI GATC 1 cut(s) 136
ScrFI CCNGG 2 cut(s) 193, 540
Sfr274I CTCGAG 1 cut(s) 53
SlaI CTCGAG 1 cut(s) 53
SmiMI CAYNNNNRTG 1 cut(s) 404
SmlI CTYRAG 2 cut(s) 53, 102
SmoI CTYRAG 2 cut(s) 53, 102
Sse9I AATT 5 cut(s) 31, 291, 368, 471, 533
SspMI CTAG 2 cut(s) 387, 431
StyD4I CCNGG 2 cut(s) 191, 538
StyI CCWWGG 1 cut(s) 430
TaiI ACGT 1 cut(s) 408
TaqI TCGA 1 cut(s) 54
TasI AATT 5 cut(s) 31, 291, 368, 471, 533
TfiI GAWTC 2 cut(s) 251, 383
Tru1I TTAA 2 cut(s) 396, 425
Tru9I TTAA 2 cut(s) 396, 425
TscAI CASTG 2 cut(s) 235, 504
TseFI GTSAC 1 cut(s) 224
TseI GCWGC 3 cut(s) 21, 198, 335
Tsp45I GTSAC 1 cut(s) 224
TspDTI ATGAA 1 cut(s) 144
TspRI CASTG 2 cut(s) 235, 504
XapI RAATTY 1 cut(s) 368
XceI RCATGY 3 cut(s) 148, 225, 302
XhoI CTCGAG 1 cut(s) 53
XmaJI CCTAGG 1 cut(s) 430
XspI CTAG 2 cut(s) 387, 431
Zsp2I ATGCAT 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.