Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0001112

Physical Location & Seq

Genomic Coordinates Reverse (-)

58366302 .. 58367166

Gene Structure 865 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00040610.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 528 bp

ATGAGAGGTAACATTCCCAATGAGATAGGCAACTTGACCAGCTTAACATTCTTAAACTTGAAATACAATCAATTGATGGGATCAATTCCAACTACAATGGGAAGACTGGGAATATCCAAGATTGGGGATCTTCAAGATTTAGTCAATCTCTCCTTGGCCAATAATGCTTTAAGTGGCTTTATTCCTAGTTCTTTCGGCAACTTGCTAAGCCTGGAATTCTTGGATTTATCCAAAAACAATCTGTCTAGAGCGATTCCGAGTCTCGGAAGCAATGTTACATCCGCAGACTCGAATTTGTCTTTCAACGAATCGAAGGAGAAATTCCTACGGGTGGACCATTCAAAAACTCATCTCGCTCAATCATTTCTCTCAAATGCTGGACTTTGCGATGCACCCCGACTGCATGTTACATTATGCAAGAATAGTACACTTAAACCACCTTCAACTAAGGCCGGTAGATCCATCTTGAAATATATTATTCCGGGTATCATATCGCAACACTCCCGGTGGCCCTTGTATTTATTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04010 ko04016 ko04064 ko04620 ko04621 ko04624 ko04626 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 ko05169 map04010 map04016 map04064 map04620 map04621 map04624 map04626 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164 map05169

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

175

Amino Acids

19.07

Weight (kDa)

9.69

Isoelectric Point (pI)

31.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001112)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G52530 AT5G52530 AT5G52530
fragaria_vesca	FvH4_7g30110 FvH4_7g30110 FvH4_7g30110
malus_domestica	MD01G1207000.v1.1 MD07G1277900.v1.1
prunus_persica	Prupe.2G299600_v2.0.a1 Prupe.2G299600_v2.0.a1 Prupe.2G299600_v2.0.a1
pyrus_communis	pycom01g21740 pycom01g21750 pycom01g21760 pycom07g25270 pycom07g25280
rosa_chinensis	RchiOBHm_Chr1g0378101 RchiOBHm_Chr2g0114171 RchiOBHm_Chr5g0011341 RchiOBHm_Chr5g0059131 RchiOBHm_Chr5g0059181 RchiOBHm_Chr5g0081641 RchiOBHm_Chr6g0285361 RchiOBHm_Chr7g0213301
rosa_laevigata	RLG00000022088 RLG00000026472
rosa_multiflora	Rmu_co8250551.1_g000001 Rmu_co8381583.1_g000001 Rmu_co8436805.1_g000001 Rmu_co8451701.1_g000001 Rmu_sc0000197.1_g000014 Rmu_sc0000394.1_g000032 Rmu_sc0000570.1_g000003 Rmu_sc0000596.1_g000057 Rmu_sc0000596.1_g000058 Rmu_sc0000625.1_g000001 Rmu_sc0001400.1_g000013 Rmu_sc0001465.1_g000011 Rmu_sc0020454.1_g000001 Rmu_sc0023221.1_g000001 Rmu_sc0027363.1_g000004 Rmu_sc0027363.1_g000005 Rmu_ssc0000116.1_g000016
rosa_roxburghii	Rroxscaffold_156G00440290 Rroxscaffold_177G00434110 Rroxscaffold_1G00040610 Rroxscaffold_4G00280780
rosa_rugosa	Rorug01G0406300 Rorug01G0406400
rosa_samantha	Rh1AG087800 Rh1AG423500 Rh1BG385100 Rh1CG399100 Rh1DG092500 Rh1DG416300 Rh5AG528900 Rh5DG240200 Rh6DG401900
rosa_wichuraiana	Rw1G037370

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	282
AclWI	GGATC	3 cut(s)	88, 135, 453
AcoI	YGGCCR	1 cut(s)	156
AcsI	RAATTY	3 cut(s)	215, 292, 320
AfaI	GTAC	1 cut(s)	427
AfiI	CCNNNNNNNGG	3 cut(s)	123, 263, 331
AgsI	TTSAA	6 cut(s)	61, 134, 304, 342, 444, 469
AjnI	CCWGG	1 cut(s)	210
AluBI	AGCT	1 cut(s)	42
AluI	AGCT	1 cut(s)	42
Alw26I	GTCTC	1 cut(s)	266
AlwI	GGATC	3 cut(s)	88, 135, 453
AoxI	GGCC	3 cut(s)	156, 450, 509
ApoI	RAATTY	3 cut(s)	215, 292, 320
AspS9I	GGNCC	2 cut(s)	334, 510
AsuC2I	CCSGG	2 cut(s)	483, 505
AvaII	GGWCC	1 cut(s)	334
BalI	TGGCCA	1 cut(s)	158
BarI	GAAGNNNNNNTAC	2 cut(s)	259, 291
BbsI	GAAGAC	1 cut(s)	109
BccI	CCATC	2 cut(s)	70, 470
BciT130I	CCWGG	1 cut(s)	212
BcnI	CCSGG	2 cut(s)	483, 505
BcoDI	GTCTC	1 cut(s)	266
BfaI	CTAG	2 cut(s)	186, 246
BlpI	GCTNAGC	1 cut(s)	206
Bme1390I	CCNGG	3 cut(s)	212, 483, 505
Bme18I	GGWCC	1 cut(s)	334
BmgT120I	GGNCC	2 cut(s)	334, 510
BmrFI	CCNGG	3 cut(s)	212, 483, 505
BmrI	ACTGGG	1 cut(s)	116
BmsI	GCATC	1 cut(s)	379
BmuI	ACTGGG	1 cut(s)	116
BpiI	GAAGAC	1 cut(s)	109
Bpu1102I	GCTNAGC	1 cut(s)	206
BpuMI	CCSGG	2 cut(s)	483, 505
BsaJI	CCNNGG	1 cut(s)	153
Bsc4I	CCNNNNNNNGG	3 cut(s)	123, 263, 331
Bse118I	RCCGGY	1 cut(s)	452
Bse1I	ACTGG	1 cut(s)	111
Bse3DI	GCAATG	1 cut(s)	277
BseBI	CCWGG	1 cut(s)	212
BseDI	CCNNGG	1 cut(s)	153
BseGI	GGATG	1 cut(s)	278
BseLI	CCNNNNNNNGG	3 cut(s)	123, 263, 331
BseMI	GCAATG	1 cut(s)	277
BseNI	ACTGG	1 cut(s)	111
BshFI	GGCC	3 cut(s)	158, 452, 511
BsiSI	CCGG	3 cut(s)	453, 482, 505
BslI	CCNNNNNNNGG	3 cut(s)	123, 263, 331
BsmAI	GTCTC	1 cut(s)	266
BsnI	GGCC	3 cut(s)	158, 452, 511
Bsp143I	GATC	3 cut(s)	80, 127, 458
Bsp1720I	GCTNAGC	1 cut(s)	206
BspACI	CCGC	1 cut(s)	282
BspANI	GGCC	3 cut(s)	158, 452, 511
BspPI	GGATC	3 cut(s)	88, 135, 453
BsrDI	GCAATG	1 cut(s)	277
BsrFI	RCCGGY	1 cut(s)	452
BsrI	ACTGG	1 cut(s)	111
BssAI	RCCGGY	1 cut(s)	452
BssECI	CCNNGG	1 cut(s)	153
BssMI	GATC	3 cut(s)	80, 127, 458
BssT1I	CCWWGG	1 cut(s)	153
Bst2UI	CCWGG	1 cut(s)	212
BstDEI	CTNAG	2 cut(s)	206, 447
BstF5I	GGATG	1 cut(s)	278
BstKTI	GATC	3 cut(s)	83, 130, 461
BstMAI	GTCTC	1 cut(s)	266
BstMBI	GATC	3 cut(s)	80, 127, 458
BstMWI	GCNNNNNNNGC	1 cut(s)	164
BstNI	CCWGG	1 cut(s)	212
BstNSI	RCATGY	1 cut(s)	407
BstSCI	CCNGG	3 cut(s)	210, 481, 503
BstV2I	GAAGAC	1 cut(s)	109
BstX2I	RGATCY	2 cut(s)	127, 458
BstYI	RGATCY	2 cut(s)	127, 458
BsuRI	GGCC	3 cut(s)	158, 452, 511
BtgZI	GCGATG	1 cut(s)	402
BtsCI	GGATG	1 cut(s)	278
Cfr10I	RCCGGY	1 cut(s)	452
Cfr13I	GGNCC	2 cut(s)	334, 510
Csp6I	GTAC	1 cut(s)	426
CviAII	CATG	1 cut(s)	404
CviJI	RGCY	6 cut(s)	42, 158, 177, 210, 452, 511
CviKI_1	RGCY	6 cut(s)	42, 158, 177, 210, 452, 511
CviQI	GTAC	1 cut(s)	426
DdeI	CTNAG	2 cut(s)	206, 447
DpnI	GATC	3 cut(s)	82, 129, 460
DpnII	GATC	3 cut(s)	80, 127, 458
EaeI	YGGCCR	1 cut(s)	156
Eco130I	CCWWGG	1 cut(s)	153
Eco47I	GGWCC	1 cut(s)	334
EcoRI	GAATTC	1 cut(s)	215
EcoRII	CCWGG	1 cut(s)	210
EcoT14I	CCWWGG	1 cut(s)	153
ErhI	CCWWGG	1 cut(s)	153
FaeI	CATG	1 cut(s)	407
FaiI	YATR	5 cut(s)	405, 415, 474, 491, 526
FatI	CATG	1 cut(s)	403
FokI	GGATG	1 cut(s)	265
FspBI	CTAG	2 cut(s)	186, 246
HaeIII	GGCC	3 cut(s)	158, 452, 511
HapII	CCGG	3 cut(s)	453, 482, 505
Hin1II	CATG	1 cut(s)	407
HinfI	GANTC	4 cut(s)	253, 259, 287, 308
HpaII	CCGG	3 cut(s)	453, 482, 505
Hpy166II	GTNNAC	2 cut(s)	334, 428
Hpy188I	TCNGA	2 cut(s)	258, 266
Hpy188III	TCNNGA	3 cut(s)	134, 246, 466
Hpy8I	GTNNAC	2 cut(s)	334, 428
HpyAV	CCTTC	2 cut(s)	307, 450
HpyCH4V	TGCA	3 cut(s)	392, 403, 417
HpyF10VI	GCNNNNNNNGC	1 cut(s)	164
HpyF3I	CTNAG	2 cut(s)	206, 447
Hsp92II	CATG	1 cut(s)	407
Kzo9I	GATC	3 cut(s)	80, 127, 458
LpnPI	CCDG	8 cut(s)	52, 92, 197, 224, 363, 466, 495, 518
LweI	GCATC	1 cut(s)	379
MaeI	CTAG	2 cut(s)	186, 246
MaeIII	GTNAC	3 cut(s)	8, 274, 406
MalI	GATC	3 cut(s)	82, 129, 460
MboI	GATC	3 cut(s)	80, 127, 458
MboII	GAAGA	2 cut(s)	114, 122
MfeI	CAATTG	1 cut(s)	71
MflI	RGATCY	2 cut(s)	127, 458
MlsI	TGGCCA	1 cut(s)	158
MluCI	AATT	5 cut(s)	71, 84, 215, 292, 320
MluNI	TGGCCA	1 cut(s)	158
MlyI	GAGTC	2 cut(s)	268, 281
MmeI	TCCRAC	1 cut(s)	113
Mox20I	TGGCCA	1 cut(s)	158
MscI	TGGCCA	1 cut(s)	158
MseI	TTAA	4 cut(s)	44, 53, 170, 432
Msp20I	TGGCCA	1 cut(s)	158
MspI	CCGG	3 cut(s)	453, 482, 505
MspR9I	CCNGG	3 cut(s)	212, 483, 505
MunI	CAATTG	1 cut(s)	71
MvaI	CCWGG	1 cut(s)	212
MwoI	GCNNNNNNNGC	1 cut(s)	164
NciI	CCSGG	2 cut(s)	483, 505
NdeII	GATC	3 cut(s)	80, 127, 458
NlaIII	CATG	1 cut(s)	407
NspI	RCATGY	1 cut(s)	407
PfeI	GAWTC	2 cut(s)	253, 308
PleI	GAGTC	2 cut(s)	267, 281
PpsI	GAGTC	2 cut(s)	267, 281
Psp6I	CCWGG	1 cut(s)	210
PspGI	CCWGG	1 cut(s)	210
PspPI	GGNCC	2 cut(s)	334, 510
PsuI	RGATCY	2 cut(s)	127, 458
RsaI	GTAC	1 cut(s)	427
RsaNI	GTAC	1 cut(s)	426
SaqAI	TTAA	4 cut(s)	44, 53, 170, 432
Sau3AI	GATC	3 cut(s)	80, 127, 458
Sau96I	GGNCC	2 cut(s)	334, 510
SchI	GAGTC	2 cut(s)	268, 281
ScrFI	CCNGG	3 cut(s)	212, 483, 505
SetI	ASST	3 cut(s)	10, 44, 442
SfaNI	GCATC	1 cut(s)	379
SinI	GGWCC	1 cut(s)	334
Sse9I	AATT	5 cut(s)	71, 84, 215, 292, 320
SsiI	CCGC	1 cut(s)	282
SspMI	CTAG	2 cut(s)	186, 246
StyD4I	CCNGG	3 cut(s)	210, 481, 503
StyI	CCWWGG	1 cut(s)	153
TaqI	TCGA	2 cut(s)	290, 311
TasI	AATT	5 cut(s)	71, 84, 215, 292, 320
TatI	WGTACW	1 cut(s)	425
TfiI	GAWTC	2 cut(s)	253, 308
Tru1I	TTAA	4 cut(s)	44, 53, 170, 432
Tru9I	TTAA	4 cut(s)	44, 53, 170, 432
VpaK11BI	GGWCC	1 cut(s)	334
XapI	RAATTY	3 cut(s)	215, 292, 320
XbaI	TCTAGA	1 cut(s)	245
XceI	RCATGY	1 cut(s)	407
XspI	CTAG	2 cut(s)	186, 246

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.