Rmu_sc0027363.1_g000005

Phosphatidate phosphatase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027363.1
Physical Location & Seq
Reverse (-)
13724 .. 14305
582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027363.1_g000005.1.cds

Sequence Viewer

Length: 582 bp
atgaactatagctacaataacaatgcagatttttctcagtccggaggtgaaggtttttcacagcaaggcaactctgtttattcatccaatttttgttcaaagaatcagaaagaagcttctgaagctattattgaatcacttgatgcctccatatgtgatgatgttcaattggctacttgtgtttcaaatggttgtgctgaagacgatggttctgaagttgttccggttgattctggaaaatttattttggacgacattagttttatcgattctggttggaaaggagaaaactcagaaattgttgttgaatgcttggacggagatgctgagttatcagagtatgagtggtctcgatatgatagttgtgctactgagcttcttgggaaatcacataatttaaacccagaagttatattggtgagtgtggatggttatgttttgactgtccccatctcagcatcagaacagaatgcagataatttgcgtttagacatgcctcagaatgcttgggccactgattatattcataagatggatacacctagaactagcactactagaaattttcccaaagcacactga

Protein Analysis

193

Amino Acids

21.12

Weight (kDa)

4.1

Isoelectric Point (pI)

43.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 41
AcsI RAATTY 2 cut(s) 239, 562
AcuI CTGAAG 3 cut(s) 141, 219, 234
AgsI TTSAA 5 cut(s) 99, 134, 167, 186, 308
AluBI AGCT 4 cut(s) 12, 116, 125, 376
AluI AGCT 4 cut(s) 12, 116, 125, 376
Alw26I GTCTC 1 cut(s) 354
Aor13HI TCCGGA 1 cut(s) 41
AoxI GGCC 1 cut(s) 510
ApoI RAATTY 2 cut(s) 239, 562
Asp700I GAANNNNTTC 1 cut(s) 219
AspS9I GGNCC 1 cut(s) 510
AsuHPI GGTGA 2 cut(s) 59, 430
BbsI GAAGAC 1 cut(s) 207
BccI CCATC 4 cut(s) 200, 422, 458, 526
BciVI GTATCC 1 cut(s) 529
BcoDI GTCTC 1 cut(s) 354
BfaI CTAG 3 cut(s) 543, 549, 558
BfmI CTRYAG 1 cut(s) 7
BfuI GTATCC 1 cut(s) 529
BmgT120I GGNCC 1 cut(s) 510
BmsI GCATC 3 cut(s) 133, 313, 467
BpiI GAAGAC 1 cut(s) 207
Bsa29I ATCGAT 1 cut(s) 267
BsaI GGTCTC 1 cut(s) 354
BsaWI WCCGGW 2 cut(s) 41, 223
BseAI TCCGGA 1 cut(s) 41
BseCI ATCGAT 1 cut(s) 267
BseGI GGATG 2 cut(s) 83, 433
BseMII CTCAG 6 cut(s) 50, 306, 318, 363, 468, 512
BshFI GGCC 1 cut(s) 512
BshVI ATCGAT 1 cut(s) 267
BsiSI CCGG 2 cut(s) 42, 224
BslFI GGGAC 1 cut(s) 431
BsmAI GTCTC 1 cut(s) 354
BsmFI GGGAC 1 cut(s) 431
BsmI GAATGC 3 cut(s) 314, 475, 508
BsnI GGCC 1 cut(s) 512
Bso31I GGTCTC 1 cut(s) 354
Bsp13I TCCGGA 1 cut(s) 41
BspANI GGCC 1 cut(s) 512
BspCNI CTCAG 6 cut(s) 49, 305, 319, 364, 467, 511
BspDI ATCGAT 1 cut(s) 267
BspEI TCCGGA 1 cut(s) 41
BspTNI GGTCTC 1 cut(s) 354
Bst4CI ACNGT 1 cut(s) 445
BstDEI CTNAG 6 cut(s) 36, 292, 327, 372, 454, 498
BstF5I GGATG 2 cut(s) 83, 433
BstMAI GTCTC 1 cut(s) 354
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstNSI RCATGY 1 cut(s) 496
BstSFI CTRYAG 1 cut(s) 7
BstV2I GAAGAC 1 cut(s) 207
Bsu15I ATCGAT 1 cut(s) 267
BsuI GTATCC 1 cut(s) 529
BsuRI GGCC 1 cut(s) 512
BsuTUI ATCGAT 1 cut(s) 267
BtsCI GGATG 2 cut(s) 83, 433
BtsIMutI CAGTG 2 cut(s) 513, 577
Cfr13I GGNCC 1 cut(s) 510
ClaI ATCGAT 1 cut(s) 267
CviAII CATG 1 cut(s) 493
CviJI RGCY 6 cut(s) 12, 116, 125, 173, 376, 512
CviKI_1 RGCY 6 cut(s) 12, 116, 125, 173, 376, 512
DdeI CTNAG 6 cut(s) 36, 292, 327, 372, 454, 498
DraI TTTAAA 1 cut(s) 399
Eco31I GGTCTC 1 cut(s) 354
Eco57I CTGAAG 3 cut(s) 141, 219, 234
FaeI CATG 1 cut(s) 496
FaqI GGGAC 1 cut(s) 431
FatI CATG 1 cut(s) 492
FauNDI CATATG 1 cut(s) 152
FokI GGATG 2 cut(s) 70, 440
FspBI CTAG 3 cut(s) 543, 549, 558
HaeIII GGCC 1 cut(s) 512
HapII CCGG 2 cut(s) 42, 224
Hin1II CATG 1 cut(s) 496
HindIII AAGCTT 1 cut(s) 114
HinfI GANTC 4 cut(s) 103, 134, 230, 269
HpaII CCGG 2 cut(s) 42, 224
HphI GGTGA 2 cut(s) 59, 430
Hpy188I TCNGA 7 cut(s) 108, 121, 214, 295, 337, 463, 501
Hpy188III TCNNGA 3 cut(s) 42, 234, 351
HpyAV CCTTC 1 cut(s) 44
HpyCH4III ACNGT 1 cut(s) 445
HpyCH4V TGCA 2 cut(s) 26, 473
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpyF3I CTNAG 6 cut(s) 36, 292, 327, 372, 454, 498
Hsp92II CATG 1 cut(s) 496
Kpn2I TCCGGA 1 cut(s) 41
LpnPI CCDG 5 cut(s) 55, 219, 237, 258, 417
LweI GCATC 3 cut(s) 133, 313, 467
MaeI CTAG 3 cut(s) 543, 549, 558
MboII GAAGA 1 cut(s) 212
MfeI CAATTG 1 cut(s) 167
MluCI AATT 7 cut(s) 88, 167, 239, 297, 394, 478, 562
MmeI TCCRAC 1 cut(s) 257
MnlI CCTC 3 cut(s) 38, 157, 507
MroI TCCGGA 1 cut(s) 41
MroXI GAANNNNTTC 1 cut(s) 219
MseI TTAA 1 cut(s) 398
MspI CCGG 2 cut(s) 42, 224
MunI CAATTG 1 cut(s) 167
Mva1269I GAATGC 3 cut(s) 314, 475, 508
MwoI GCNNNNNNNGC 1 cut(s) 122
NdeI CATATG 1 cut(s) 152
NlaIII CATG 1 cut(s) 496
NspI RCATGY 1 cut(s) 496
PctI GAATGC 3 cut(s) 314, 475, 508
PdmI GAANNNNTTC 1 cut(s) 219
PfeI GAWTC 4 cut(s) 103, 134, 230, 269
PspPI GGNCC 1 cut(s) 510
PsrI GAACNNNNNNTAC 3 cut(s) 28, 538, 570
SaqAI TTAA 1 cut(s) 398
Sau96I GGNCC 1 cut(s) 510
SetI ASST 7 cut(s) 14, 49, 55, 118, 127, 378, 544
SfaNI GCATC 3 cut(s) 133, 313, 467
SfcI CTRYAG 1 cut(s) 7
Sse9I AATT 7 cut(s) 88, 167, 239, 297, 394, 478, 562
SspMI CTAG 3 cut(s) 543, 549, 558
TaaI ACNGT 1 cut(s) 445
TaqI TCGA 2 cut(s) 267, 352
TasI AATT 7 cut(s) 88, 167, 239, 297, 394, 478, 562
TfiI GAWTC 4 cut(s) 103, 134, 230, 269
Tru1I TTAA 1 cut(s) 398
Tru9I TTAA 1 cut(s) 398
TscAI CASTG 1 cut(s) 520
TspDTI ATGAA 3 cut(s) 17, 72, 515
TspGWI ACGGA 1 cut(s) 333
TspRI CASTG 1 cut(s) 520
XapI RAATTY 2 cut(s) 239, 562
XceI RCATGY 1 cut(s) 496
XmnI GAANNNNTTC 1 cut(s) 219
XspI CTAG 3 cut(s) 543, 549, 558
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.