Rmu_sc0000596.1_g000058

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000596.1
OG0001112
Physical Location & Seq
Reverse (-)
296099 .. 296692
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000596.1_g000058.1.cds

Sequence Viewer

Length: 594 bp
atgggagtttatatggctgatgaagacatagtagtcttggttcttcatggtttaccctcagagtttgctaccataaaaactgtaataagaatcaaaacactaagctcctctgtttcaatgaaagaattacgatctcttttgttgatagctaaagatgagattgaacaaactgtgaagtctatttctgagaggttcaggaatgaaatgatggcacatgttgatagtttcaaaaggacatgtgacactaatgctgttgatggctctgtatcaagaaaagtggaatatagagaaaatgaattttgtgggatagaatctaggaagattaacatggacatgcaggttgtgcgaggattgagcccgggttttgataatatgtgtgaaaaagttgaacattgtgtgattaaaaatgttttgagacaatcttcagtggggttaaagacgagaacttatggatctgaacaattgcttggtgattctgaagctttttcaaacagaactacagaagcaactgatgagggctgcacaataaggaagcatactggtgactactttgatggtcttaatggcaaagatcttgtcaaagttgatagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

197

Amino Acids

22.17

Weight (kDa)

5.87

Isoelectric Point (pI)

35.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 32
Acc36I ACCTGC 1 cut(s) 328
AclWI GGATC 1 cut(s) 460
AcsI RAATTY 1 cut(s) 296
AcuI CTGAAG 2 cut(s) 408, 498
AflIII ACRYGT 2 cut(s) 214, 236
AgsI TTSAA 5 cut(s) 117, 164, 229, 389, 489
AjuI GAANNNNNNNTTGG 2 cut(s) 450, 482
AluBI AGCT 3 cut(s) 105, 149, 482
AluI AGCT 3 cut(s) 105, 149, 482
Alw26I GTCTC 1 cut(s) 409
AlwI GGATC 1 cut(s) 460
Ama87I CYCGRG 1 cut(s) 358
ApeKI GCWGC 1 cut(s) 519
ApoI RAATTY 1 cut(s) 296
ArsI GACNNNNNNTTYG 2 cut(s) 561, 593
AsuC2I CCSGG 2 cut(s) 359, 360
AsuHPI GGTGA 2 cut(s) 482, 554
AvaI CYCGRG 1 cut(s) 358
BanII GRGCYC 1 cut(s) 359
BbsI GAAGAC 1 cut(s) 30
BbvI GCAGC 1 cut(s) 506
BccI CCATC 3 cut(s) 202, 251, 548
BcnI CCSGG 2 cut(s) 359, 360
BcoDI GTCTC 1 cut(s) 409
BfaI CTAG 1 cut(s) 315
BfmI CTRYAG 1 cut(s) 498
BfuAI ACCTGC 1 cut(s) 328
BglII AGATCT 1 cut(s) 571
BisI GCNGC 1 cut(s) 520
BlsI GCNGC 1 cut(s) 521
Bme1390I CCNGG 2 cut(s) 359, 360
BmeT110I CYCGRG 1 cut(s) 358
BmrFI CCNGG 2 cut(s) 359, 360
BpiI GAAGAC 1 cut(s) 30
BpuMI CCSGG 2 cut(s) 359, 360
BsaJI CCNNGG 1 cut(s) 358
Bse1I ACTGG 1 cut(s) 544
BseDI CCNNGG 1 cut(s) 358
BseMII CTCAG 2 cut(s) 72, 177
BseNI ACTGG 1 cut(s) 544
BseRI GAGGAG 1 cut(s) 97
BseXI GCAGC 1 cut(s) 506
BsgI GTGCAG 1 cut(s) 505
BsiHKCI CYCGRG 1 cut(s) 358
BsiSI CCGG 1 cut(s) 359
BsmAI GTCTC 1 cut(s) 409
BsoBI CYCGRG 1 cut(s) 358
Bsp1286I GDGCHC 1 cut(s) 359
Bsp143I GATC 3 cut(s) 131, 452, 571
BspCNI CTCAG 2 cut(s) 71, 178
BspMI ACCTGC 1 cut(s) 328
BspPI GGATC 1 cut(s) 460
BsrI ACTGG 1 cut(s) 544
BssECI CCNNGG 1 cut(s) 358
BssMI GATC 3 cut(s) 131, 452, 571
Bst4CI ACNGT 2 cut(s) 82, 172
BstAPI GCANNNNNTGC 1 cut(s) 343
BstDEI CTNAG 3 cut(s) 58, 101, 186
BstKTI GATC 3 cut(s) 134, 455, 574
BstMAI GTCTC 1 cut(s) 409
BstMBI GATC 3 cut(s) 131, 452, 571
BstMWI GCNNNNNNNGC 1 cut(s) 343
BstNSI RCATGY 3 cut(s) 218, 240, 337
BstSCI CCNGG 2 cut(s) 357, 358
BstSFI CTRYAG 1 cut(s) 498
BstV1I GCAGC 1 cut(s) 506
BstV2I GAAGAC 1 cut(s) 30
BstX2I RGATCY 2 cut(s) 452, 571
BstYI RGATCY 2 cut(s) 452, 571
BtsIMutI CAGTG 1 cut(s) 432
BveI ACCTGC 1 cut(s) 328
Cfr9I CCCGGG 1 cut(s) 358
CspCI CAANNNNNGTGG 2 cut(s) 258, 293
CviAII CATG 5 cut(s) 47, 215, 237, 328, 334
CviJI RGCY 7 cut(s) 17, 105, 149, 261, 357, 482, 519
CviKI_1 RGCY 7 cut(s) 17, 105, 149, 261, 357, 482, 519
DdeI CTNAG 3 cut(s) 58, 101, 186
DpnI GATC 3 cut(s) 133, 454, 573
DpnII GATC 3 cut(s) 131, 452, 571
DrdI GACNNNNNNGTC 1 cut(s) 32
DseDI GACNNNNNNGTC 1 cut(s) 32
Eco24I GRGCYC 1 cut(s) 359
Eco57I CTGAAG 2 cut(s) 408, 498
Eco88I CYCGRG 1 cut(s) 358
EcoT38I GRGCYC 1 cut(s) 359
FaeI CATG 5 cut(s) 50, 218, 240, 331, 337
FatI CATG 5 cut(s) 46, 214, 236, 327, 333
Fnu4HI GCNGC 1 cut(s) 520
FriOI GRGCYC 1 cut(s) 359
Fsp4HI GCNGC 1 cut(s) 520
FspBI CTAG 1 cut(s) 315
GluI GCNGC 1 cut(s) 520
HapII CCGG 1 cut(s) 359
Hin1II CATG 5 cut(s) 50, 218, 240, 331, 337
HindIII AAGCTT 1 cut(s) 480
HinfI GANTC 3 cut(s) 90, 311, 473
HpaII CCGG 1 cut(s) 359
HphI GGTGA 2 cut(s) 482, 554
Hpy166II GTNNAC 1 cut(s) 53
Hpy188I TCNGA 4 cut(s) 61, 187, 457, 478
Hpy188III TCNNGA 2 cut(s) 196, 270
Hpy8I GTNNAC 1 cut(s) 53
HpyCH4III ACNGT 2 cut(s) 82, 172
HpyCH4V TGCA 2 cut(s) 337, 522
HpyF10VI GCNNNNNNNGC 1 cut(s) 343
HpyF3I CTNAG 3 cut(s) 58, 101, 186
Hsp92II CATG 5 cut(s) 50, 218, 240, 331, 337
Kzo9I GATC 3 cut(s) 131, 452, 571
LmnI GCTCC 1 cut(s) 110
LpnPI CCDG 4 cut(s) 181, 323, 372, 525
Lsp1109I GCAGC 1 cut(s) 506
MaeI CTAG 1 cut(s) 315
MaeIII GTNAC 2 cut(s) 239, 542
MalI GATC 3 cut(s) 133, 454, 573
MboI GATC 3 cut(s) 131, 452, 571
MboII GAAGA 4 cut(s) 35, 35, 331, 414
MfeI CAATTG 1 cut(s) 461
MflI RGATCY 2 cut(s) 452, 571
MhlI GDGCHC 1 cut(s) 359
MluCI AATT 3 cut(s) 125, 296, 461
MnlI CCTC 5 cut(s) 67, 118, 183, 341, 508
MseI TTAA 4 cut(s) 324, 402, 434, 561
MslI CAYNNNNRTG 2 cut(s) 332, 540
MspI CCGG 1 cut(s) 359
MspR9I CCNGG 2 cut(s) 359, 360
MunI CAATTG 1 cut(s) 461
MwoI GCNNNNNNNGC 1 cut(s) 343
NciI CCSGG 2 cut(s) 359, 360
NdeII GATC 3 cut(s) 131, 452, 571
NlaIII CATG 5 cut(s) 50, 218, 240, 331, 337
NmuCI GTSAC 2 cut(s) 239, 542
NspI RCATGY 3 cut(s) 218, 240, 337
PciI ACATGT 2 cut(s) 214, 236
PfeI GAWTC 3 cut(s) 90, 311, 473
PkrI GCNGC 1 cut(s) 521
PscI ACATGT 2 cut(s) 214, 236
PsrI GAACNNNNNNTAC 2 cut(s) 24, 56
PsuI RGATCY 2 cut(s) 452, 571
RseI CAYNNNNRTG 2 cut(s) 332, 540
SaqAI TTAA 4 cut(s) 324, 402, 434, 561
SatI GCNGC 1 cut(s) 520
Sau3AI GATC 3 cut(s) 131, 452, 571
ScrFI CCNGG 2 cut(s) 359, 360
SduI GDGCHC 1 cut(s) 359
SetI ASST 5 cut(s) 107, 151, 194, 342, 484
SfcI CTRYAG 1 cut(s) 498
SmaI CCCGGG 1 cut(s) 360
SmiMI CAYNNNNRTG 2 cut(s) 332, 540
Sse9I AATT 3 cut(s) 125, 296, 461
SspMI CTAG 1 cut(s) 315
StyD4I CCNGG 2 cut(s) 357, 358
TaaI ACNGT 2 cut(s) 82, 172
TasI AATT 3 cut(s) 125, 296, 461
TfiI GAWTC 3 cut(s) 90, 311, 473
Tru1I TTAA 4 cut(s) 324, 402, 434, 561
Tru9I TTAA 4 cut(s) 324, 402, 434, 561
TscAI CASTG 1 cut(s) 432
TseFI GTSAC 2 cut(s) 239, 542
TseI GCWGC 1 cut(s) 519
Tsp45I GTSAC 2 cut(s) 239, 542
TspDTI ATGAA 5 cut(s) 35, 36, 134, 216, 309
TspMI CCCGGG 1 cut(s) 358
TspRI CASTG 1 cut(s) 432
XapI RAATTY 1 cut(s) 296
XceI RCATGY 3 cut(s) 218, 240, 337
XmaI CCCGGG 1 cut(s) 358
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.