Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000295.1

Orthogroup ID

OG0001772

Physical Location & Seq

Genomic Coordinates Reverse (-)

128396 .. 129692

Gene Structure 1297 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000295.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 708 bp

atgttggctgcccagataccaattactcttggaatcattgcagaaaaaattaaggtttctggaaattgtacagattgtctacttgtcttggcggaaagcttgagaacatttggaccttgtatcactaattttcaagctaaagtaaaggatttctggaatgagcatggctggaacatggatttattaagatcggtgctgcctgatgatctgattagccaaaaaattgtgaagatccctgctggatatgctggttgtggttctgataagctcatatggggtgctactttgactggtaagttctcagttaaatctgcataccttactttacttcaagatgagaattatactccctttaattgggcttttatttggaaaatggctattcctcccaagctgaaatctttttcctggcttatatgtcatggaaaattgctaacgaatgtggaaagagtcaagagaagaatgtcctctgactcttcttgcactctttgccataacgctcctgaaactattatgcacttgttaagagattgttctcatgcctcctctatatggaataggatcatttgtttggataccattactatagctatgcatctggattggatgagctggttggcagcaaatattcgatgcaagagaacttgttatggagagttaaattggtgtattgtctttgtttttgcttgctggtacatctggaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

235

Amino Acids

26.8

Weight (kDa)

8.77

Isoelectric Point (pI)

46.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001772)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g04886 FvH4_2g12003 FvH4_5g27492
rosa_chinensis	RchiOBHm_Chr1g0382551 RchiOBHm_Chr1g0384551
rosa_laevigata	RLG00000002160
rosa_multiflora	Rmu_co8264107.1_g000001 Rmu_co8333359.1_g000001 Rmu_sc0000295.1_g000023 Rmu_sc0000657.1_g000002 Rmu_sc0000935.1_g000036 Rmu_sc0001150.1_g000003 Rmu_sc0001484.1_g000025 Rmu_sc0001512.1_g000020 Rmu_sc0001618.1_g000002 Rmu_sc0001809.1_g000022 Rmu_sc0002354.1_g000044 Rmu_sc0002522.1_g000061 Rmu_sc0004175.1_g000004 Rmu_sc0004200.1_g000003 Rmu_sc0004569.1_g000010 Rmu_sc0005950.1_g000002 Rmu_sc0006862.1_g000009 Rmu_sc0007977.1_g000017 Rmu_sc0008049.1_g000020 Rmu_sc0008752.1_g000003 Rmu_sc0009440.1_g000002 Rmu_sc0009969.1_g000003 Rmu_sc0010108.1_g000001 Rmu_sc0010822.1_g000003 Rmu_sc0010883.1_g000006 Rmu_sc0017237.1_g000001 Rmu_sc0018807.1_g000013 Rmu_sc0027036.1_g000002 Rmu_sc0033849.1_g000001 Rmu_ssc0000387.1_g000008
rosa_roxburghii	Rroxscaffold_2G00087680 Rroxscaffold_3G00224640 Rroxscaffold_7G00179230
rosa_rugosa	Rorug01G0040100 Rorug01G0390700 Rorug02G0557500 Rorug03G0004200 Rorug04G0040100 Rorug07G0095000 Rorug07G0277300
rosa_samantha	Rh5BG202500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	79
AciI	CCGC	1 cut(s)	92
AclWI	GGATC	2 cut(s)	226, 569
AfaI	GTAC	2 cut(s)	70, 695
AfiI	CCNNNNNNNGG	2 cut(s)	357, 552
AgsI	TTSAA	2 cut(s)	134, 332
AjnI	CCWGG	1 cut(s)	407
AluBI	AGCT	6 cut(s)	99, 137, 268, 394, 590, 612
AluI	AGCT	6 cut(s)	99, 137, 268, 394, 590, 612
AlwI	GGATC	2 cut(s)	226, 569
ApeKI	GCWGC	3 cut(s)	8, 196, 620
AspS9I	GGNCC	1 cut(s)	113
AvaII	GGWCC	1 cut(s)	113
BbvI	GCAGC	2 cut(s)	183, 632
BciT130I	CCWGG	1 cut(s)	409
BciVI	GTATCC	1 cut(s)	568
BfmI	CTRYAG	1 cut(s)	585
BfuI	GTATCC	1 cut(s)	568
BisI	GCNGC	3 cut(s)	9, 197, 621
BlsI	GCNGC	3 cut(s)	10, 198, 622
Bme1390I	CCNGG	1 cut(s)	409
Bme18I	GGWCC	1 cut(s)	113
BmgT120I	GGNCC	1 cut(s)	113
BmrFI	CCNGG	1 cut(s)	409
BmsI	GCATC	2 cut(s)	604, 623
BpuEI	CTTGAG	1 cut(s)	121
Bsc4I	CCNNNNNNNGG	2 cut(s)	357, 552
Bse1I	ACTGG	1 cut(s)	295
Bse3DI	GCAATG	1 cut(s)	36
BseBI	CCWGG	1 cut(s)	409
BseGI	GGATG	1 cut(s)	612
BseLI	CCNNNNNNNGG	2 cut(s)	357, 552
BseMI	GCAATG	1 cut(s)	36
BseMII	CTCAG	1 cut(s)	315
BseNI	ACTGG	1 cut(s)	295
BseRI	GAGGAG	1 cut(s)	535
BseXI	GCAGC	2 cut(s)	183, 632
BslI	CCNNNNNNNGG	2 cut(s)	357, 552
Bsp1407I	TGTACA	1 cut(s)	68
Bsp143I	GATC	4 cut(s)	188, 205, 231, 561
BspACI	CCGC	1 cut(s)	92
BspCNI	CTCAG	1 cut(s)	314
BspPI	GGATC	2 cut(s)	226, 569
BsrDI	GCAATG	1 cut(s)	36
BsrGI	TGTACA	1 cut(s)	68
BsrI	ACTGG	1 cut(s)	295
BssMI	GATC	4 cut(s)	188, 205, 231, 561
Bst2UI	CCWGG	1 cut(s)	409
Bst6I	CTCTTC	1 cut(s)	481
BstAPI	GCANNNNNTGC	1 cut(s)	489
BstAUI	TGTACA	1 cut(s)	68
BstC8I	GCNNGC	1 cut(s)	688
BstDEI	CTNAG	1 cut(s)	301
BstF5I	GGATG	1 cut(s)	612
BstKTI	GATC	4 cut(s)	191, 208, 234, 564
BstMBI	GATC	4 cut(s)	188, 205, 231, 561
BstMWI	GCNNNNNNNGC	2 cut(s)	245, 489
BstNI	CCWGG	1 cut(s)	409
BstSCI	CCNGG	1 cut(s)	407
BstSFI	CTRYAG	1 cut(s)	585
BstV1I	GCAGC	2 cut(s)	183, 632
BstX2I	RGATCY	1 cut(s)	231
BstYI	RGATCY	1 cut(s)	231
BsuI	GTATCC	1 cut(s)	568
BtsCI	GGATG	1 cut(s)	612
Cac8I	GCNNGC	1 cut(s)	688
Cfr13I	GGNCC	1 cut(s)	113
Csp6I	GTAC	2 cut(s)	69, 694
CviAII	CATG	4 cut(s)	164, 175, 422, 539
CviQI	GTAC	2 cut(s)	69, 694
DdeI	CTNAG	1 cut(s)	301
DpnI	GATC	4 cut(s)	190, 207, 233, 563
DpnII	GATC	4 cut(s)	188, 205, 231, 561
Eam1104I	CTCTTC	1 cut(s)	481
EarI	CTCTTC	1 cut(s)	481
EciI	GGCGGA	1 cut(s)	107
Eco47I	GGWCC	1 cut(s)	113
EcoRII	CCWGG	1 cut(s)	407
EcoT22I	ATGCAT	1 cut(s)	597
FaeI	CATG	4 cut(s)	167, 178, 425, 542
FatI	CATG	4 cut(s)	163, 174, 421, 538
FauNDI	CATATG	1 cut(s)	272
FblI	GTMKAC	1 cut(s)	79
Fnu4HI	GCNGC	3 cut(s)	9, 197, 621
FokI	GGATG	1 cut(s)	619
Fsp4HI	GCNGC	3 cut(s)	9, 197, 621
GluI	GCNGC	3 cut(s)	9, 197, 621
Hin1II	CATG	4 cut(s)	167, 178, 425, 542
HindIII	AAGCTT	1 cut(s)	97
HinfI	GANTC	3 cut(s)	33, 450, 473
Hpy166II	GTNNAC	1 cut(s)	80
Hpy188I	TCNGA	3 cut(s)	210, 262, 472
Hpy188III	TCNNGA	7 cut(s)	60, 154, 332, 454, 503, 599, 700
Hpy8I	GTNNAC	1 cut(s)	80
HpyCH4V	TGCA	6 cut(s)	41, 314, 483, 517, 595, 636
HpyF10VI	GCNNNNNNNGC	2 cut(s)	245, 489
HpyF3I	CTNAG	1 cut(s)	301
Hsp92II	CATG	4 cut(s)	167, 178, 425, 542
Kzo9I	GATC	4 cut(s)	188, 205, 231, 561
LmnI	GCTCC	1 cut(s)	505
Lsp1109I	GCAGC	2 cut(s)	183, 632
LweI	GCATC	2 cut(s)	604, 623
MalI	GATC	4 cut(s)	190, 207, 233, 563
MboI	GATC	4 cut(s)	188, 205, 231, 561
MboII	GAAGA	3 cut(s)	241, 468, 471
MflI	RGATCY	1 cut(s)	231
MluCI	AATT	9 cut(s)	21, 48, 64, 127, 222, 340, 355, 428, 661
MlyI	GAGTC	2 cut(s)	459, 467
MnlI	CCTC	4 cut(s)	396, 478, 553, 556
Mph1103I	ATGCAT	1 cut(s)	597
MseI	TTAA	6 cut(s)	51, 185, 306, 354, 524, 659
MspR9I	CCNGG	1 cut(s)	409
MvaI	CCWGG	1 cut(s)	409
MwoI	GCNNNNNNNGC	2 cut(s)	245, 489
NdeI	CATATG	1 cut(s)	272
NdeII	GATC	4 cut(s)	188, 205, 231, 561
NlaIII	CATG	4 cut(s)	167, 178, 425, 542
NsiI	ATGCAT	1 cut(s)	597
PfeI	GAWTC	1 cut(s)	33
PkrI	GCNGC	3 cut(s)	10, 198, 622
PleI	GAGTC	2 cut(s)	458, 467
PpsI	GAGTC	2 cut(s)	458, 467
Psp6I	CCWGG	1 cut(s)	407
PspGI	CCWGG	1 cut(s)	407
PspPI	GGNCC	1 cut(s)	113
PsuI	RGATCY	1 cut(s)	231
RsaI	GTAC	2 cut(s)	70, 695
RsaNI	GTAC	2 cut(s)	69, 694
SaqAI	TTAA	6 cut(s)	51, 185, 306, 354, 524, 659
SatI	GCNGC	3 cut(s)	9, 197, 621
Sau3AI	GATC	4 cut(s)	188, 205, 231, 561
Sau96I	GGNCC	1 cut(s)	113
SchI	GAGTC	2 cut(s)	459, 467
ScrFI	CCNGG	1 cut(s)	409
SetI	ASST	9 cut(s)	57, 101, 118, 139, 270, 321, 396, 592, 614
SfaNI	GCATC	2 cut(s)	604, 623
SfcI	CTRYAG	1 cut(s)	585
SinI	GGWCC	1 cut(s)	113
SmlI	CTYRAG	1 cut(s)	100
SmoI	CTYRAG	1 cut(s)	100
Sse9I	AATT	9 cut(s)	21, 48, 64, 127, 222, 340, 355, 428, 661
SsiI	CCGC	1 cut(s)	92
SspI	AATATT	1 cut(s)	628
StyD4I	CCNGG	1 cut(s)	407
TaqI	TCGA	1 cut(s)	631
TasI	AATT	9 cut(s)	21, 48, 64, 127, 222, 340, 355, 428, 661
TatI	WGTACW	1 cut(s)	68
TfiI	GAWTC	1 cut(s)	33
Tru1I	TTAA	6 cut(s)	51, 185, 306, 354, 524, 659
Tru9I	TTAA	6 cut(s)	51, 185, 306, 354, 524, 659
TseI	GCWGC	3 cut(s)	8, 196, 620
VpaK11BI	GGWCC	1 cut(s)	113
XmiI	GTMKAC	1 cut(s)	79
Zsp2I	ATGCAT	1 cut(s)	597

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.