Rmu_sc0001484.1_g000025

Ribonuclease H

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001484.1
OG0001772
Physical Location & Seq
Forward (+)
104136 .. 105089
954 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001484.1_g000025.1.cds

Sequence Viewer

Length: 954 bp
atgcccttacttcatggtagagttaacaaagatacttactcagggattgtcgataaggttcaagctaggcttgctagctggaaaagcaagaccttgaatatggcgggacaaataactcttatccaagcagttagctcttctattcctatttactcaatgcaaactgcaaaattacctattcatatttgtgataagttgggcaaactgaatagagattttttatggggtgatactgaacaaaaaaggaaagttcatctccttaattgggaagttgtgtgtaaacctaagagtgatggtggtctagggattaaaaagactgcaagcatgaatcaagatatgcttgctaaagccagctggaggattttacagggtgataaaggattatggtgcaaaatttacaaggacaagtacttgcgtaatgcatcgttgttgtctcctacatatgaaaagcctaagaattgctctagtacttggtctagtgtagtctttggtgctaatttgttgaagcttggtcttcgctggagagtgggaagtggaactcaaatcaacttttggaatgacagttggtctacagctggagctcttagacatttcgttacggacactaaccttattaatgatagtgctactgttgatgattttttgcaggatgattattggaatattgatttgctcaaaacttgtttaccatctcaaataattgataccatcacttgtattcctgtgttcatggagtactcaaatgataaactcatatggggtggtactaccaatggtattttctcagtcaagtcagcctattatcaattatgcagagatcaaaatgctcataacttcaggtggaatgaaatttggtctcttgctatccctccaaaattaaaggtctttttatggatcttagtgcaggggaatctactcatgaatgaacaaagattcagaaggcatattgcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

317

Amino Acids

36.22

Weight (kDa)

9.46

Isoelectric Point (pI)

30.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 569
AciI CCGC 1 cut(s) 104
AclWI GGATC 1 cut(s) 902
AcsI RAATTY 2 cut(s) 393, 849
AcuI CTGAAG 1 cut(s) 820
AfaI GTAC 4 cut(s) 410, 469, 737, 766
AfiI CCNNNNNNNGG 2 cut(s) 265, 357
AgsI TTSAA 3 cut(s) 62, 97, 505
AhdI GACNNNNNGTC 1 cut(s) 565
AjuI GAANNNNNNNTTGG 2 cut(s) 764, 796
AluBI AGCT 7 cut(s) 65, 78, 135, 354, 508, 575, 581
AluI AGCT 7 cut(s) 65, 78, 135, 354, 508, 575, 581
Alw21I GWGCWC 1 cut(s) 583
Alw26I GTCTC 2 cut(s) 438, 861
AlwI GGATC 1 cut(s) 902
ApoI RAATTY 2 cut(s) 393, 849
AseI ATTAAT 1 cut(s) 615
AsuHPI GGTGA 2 cut(s) 239, 383
AsuNHI GCTAGC 1 cut(s) 74
BanII GRGCYC 1 cut(s) 583
BbsI GAAGAC 1 cut(s) 506
Bbv12I GWGCWC 1 cut(s) 583
BccI CCATC 3 cut(s) 287, 697, 716
BcoDI GTCTC 2 cut(s) 438, 861
BfaI CTAG 5 cut(s) 66, 75, 302, 465, 477
BfmI CTRYAG 1 cut(s) 570
BmcAI AGTACT 3 cut(s) 410, 469, 737
BmeRI GACNNNNNGTC 1 cut(s) 565
BmsI GCATC 1 cut(s) 431
BmtI GCTAGC 1 cut(s) 78
BpiI GAAGAC 1 cut(s) 506
BpmI CTGGAG 3 cut(s) 376, 541, 597
BsaI GGTCTC 1 cut(s) 861
Bsc4I CCNNNNNNNGG 2 cut(s) 265, 357
BseGI GGATG 1 cut(s) 655
BseLI CCNNNNNNNGG 2 cut(s) 265, 357
BseMII CTCAG 2 cut(s) 54, 798
BsgI GTGCAG 1 cut(s) 923
BsiHKAI GWGCWC 1 cut(s) 583
BslFI GGGAC 1 cut(s) 120
BslI CCNNNNNNNGG 2 cut(s) 265, 357
BsmAI GTCTC 2 cut(s) 438, 861
BsmFI GGGAC 1 cut(s) 120
Bso31I GGTCTC 1 cut(s) 861
Bsp1286I GDGCHC 1 cut(s) 583
Bsp143I GATC 2 cut(s) 817, 894
BspACI CCGC 1 cut(s) 104
BspCNI CTCAG 2 cut(s) 53, 797
BspHI TCATGA 1 cut(s) 918
BspOI GCTAGC 1 cut(s) 78
BspPI GGATC 1 cut(s) 902
BspQI GCTCTTC 1 cut(s) 142
BspTNI GGTCTC 1 cut(s) 861
BssMI GATC 2 cut(s) 817, 894
Bst4CI ACNGT 2 cut(s) 563, 631
Bst6I CTCTTC 1 cut(s) 142
BstC8I GCNNGC 5 cut(s) 72, 76, 322, 342, 352
BstDEI CTNAG 7 cut(s) 40, 285, 453, 584, 784, 898, 951
BstF5I GGATG 1 cut(s) 655
BstKTI GATC 2 cut(s) 820, 897
BstMAI GTCTC 2 cut(s) 438, 861
BstMBI GATC 2 cut(s) 817, 894
BstMWI GCNNNNNNNGC 2 cut(s) 71, 84
BstSFI CTRYAG 1 cut(s) 570
BstV2I GAAGAC 1 cut(s) 506
BstX2I RGATCY 1 cut(s) 894
BstYI RGATCY 1 cut(s) 894
BtsCI GGATG 1 cut(s) 655
Cac8I GCNNGC 5 cut(s) 72, 76, 322, 342, 352
CciI TCATGA 1 cut(s) 918
Csp6I GTAC 4 cut(s) 409, 468, 736, 765
CviAII CATG 4 cut(s) 14, 325, 730, 919
CviQI GTAC 4 cut(s) 409, 468, 736, 765
DdeI CTNAG 7 cut(s) 40, 285, 453, 584, 784, 898, 951
DpnI GATC 2 cut(s) 819, 896
DpnII GATC 2 cut(s) 817, 894
DriI GACNNNNNGTC 1 cut(s) 565
Eam1104I CTCTTC 1 cut(s) 142
Eam1105I GACNNNNNGTC 1 cut(s) 565
EarI CTCTTC 1 cut(s) 142
Ecl136II GAGCTC 1 cut(s) 581
Eco24I GRGCYC 1 cut(s) 583
Eco31I GGTCTC 1 cut(s) 861
Eco53kI GAGCTC 1 cut(s) 581
Eco57I CTGAAG 1 cut(s) 820
EcoICRI GAGCTC 1 cut(s) 581
EcoT22I ATGCAT 1 cut(s) 424
EcoT38I GRGCYC 1 cut(s) 583
FaeI CATG 4 cut(s) 17, 328, 733, 922
FalI AAGNNNNNCTT 4 cut(s) 54, 86, 324, 356
FaqI GGGAC 1 cut(s) 120
FatI CATG 4 cut(s) 13, 324, 729, 918
FauI CCCGC 1 cut(s) 97
FauNDI CATATG 2 cut(s) 442, 755
FblI GTMKAC 1 cut(s) 569
FokI GGATG 1 cut(s) 662
FriOI GRGCYC 1 cut(s) 583
FspBI CTAG 5 cut(s) 66, 75, 302, 465, 477
GsuI CTGGAG 3 cut(s) 376, 541, 597
Hin1II CATG 4 cut(s) 17, 328, 733, 922
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HindIII AAGCTT 1 cut(s) 506
HinfI GANTC 3 cut(s) 328, 910, 933
HpaI GTTAAC 1 cut(s) 25
HphI GGTGA 2 cut(s) 239, 383
Hpy166II GTNNAC 4 cut(s) 25, 281, 570, 686
Hpy188I TCNGA 1 cut(s) 938
Hpy188III TCNNGA 2 cut(s) 332, 919
Hpy8I GTNNAC 4 cut(s) 25, 281, 570, 686
HpyAV CCTTC 1 cut(s) 933
HpyCH4III ACNGT 2 cut(s) 563, 631
HpyCH4V TGCA 8 cut(s) 160, 167, 320, 390, 422, 646, 813, 904
HpyF10VI GCNNNNNNNGC 2 cut(s) 71, 84
HpyF3I CTNAG 7 cut(s) 40, 285, 453, 584, 784, 898, 951
Hsp92II CATG 4 cut(s) 17, 328, 733, 922
KspAI GTTAAC 1 cut(s) 25
Kzo9I GATC 2 cut(s) 817, 894
LguI GCTCTTC 1 cut(s) 142
LmnI GCTCC 1 cut(s) 578
LweI GCATC 1 cut(s) 431
MaeI CTAG 5 cut(s) 66, 75, 302, 465, 477
MaeIII GTNAC 1 cut(s) 595
MalI GATC 2 cut(s) 819, 896
MboI GATC 2 cut(s) 817, 894
MboII GAAGA 2 cut(s) 129, 506
MflI RGATCY 1 cut(s) 894
MhlI GDGCHC 1 cut(s) 583
MluCI AATT 9 cut(s) 170, 262, 393, 457, 496, 699, 806, 849, 875
MnlI CCTC 2 cut(s) 351, 879
Mph1103I ATGCAT 1 cut(s) 424
MseI TTAA 5 cut(s) 24, 261, 309, 615, 878
MslI CAYNNNNRTG 1 cut(s) 186
MspA1I CMGCKG 2 cut(s) 354, 575
MwoI GCNNNNNNNGC 2 cut(s) 71, 84
NdeI CATATG 2 cut(s) 442, 755
NdeII GATC 2 cut(s) 817, 894
NheI GCTAGC 1 cut(s) 74
NlaIII CATG 4 cut(s) 17, 328, 733, 922
NsiI ATGCAT 1 cut(s) 424
PagI TCATGA 1 cut(s) 918
PciSI GCTCTTC 1 cut(s) 142
PfeI GAWTC 3 cut(s) 328, 910, 933
PshBI ATTAAT 1 cut(s) 615
Psp124BI GAGCTC 1 cut(s) 583
PsuI RGATCY 1 cut(s) 894
PvuII CAGCTG 2 cut(s) 354, 575
RsaI GTAC 4 cut(s) 410, 469, 737, 766
RsaNI GTAC 4 cut(s) 409, 468, 736, 765
RseI CAYNNNNRTG 1 cut(s) 186
SacI GAGCTC 1 cut(s) 583
SapI GCTCTTC 1 cut(s) 142
SaqAI TTAA 5 cut(s) 24, 261, 309, 615, 878
Sau3AI GATC 2 cut(s) 817, 894
ScaI AGTACT 3 cut(s) 410, 469, 737
SduI GDGCHC 1 cut(s) 583
SfaNI GCATC 1 cut(s) 431
SfcI CTRYAG 1 cut(s) 570
SmiMI CAYNNNNRTG 1 cut(s) 186
Sse9I AATT 9 cut(s) 170, 262, 393, 457, 496, 699, 806, 849, 875
SsiI CCGC 1 cut(s) 104
SspI AATATT 1 cut(s) 664
SspMI CTAG 5 cut(s) 66, 75, 302, 465, 477
SstI GAGCTC 1 cut(s) 583
TaaI ACNGT 2 cut(s) 563, 631
TaqI TCGA 1 cut(s) 51
TasI AATT 9 cut(s) 170, 262, 393, 457, 496, 699, 806, 849, 875
TatI WGTACW 3 cut(s) 408, 467, 735
TfiI GAWTC 3 cut(s) 328, 910, 933
Tru1I TTAA 5 cut(s) 24, 261, 309, 615, 878
Tru9I TTAA 5 cut(s) 24, 261, 309, 615, 878
TspDTI ATGAA 8 cut(s) 170, 242, 341, 459, 718, 861, 935, 939
TspGWI ACGGA 1 cut(s) 614
VspI ATTAAT 1 cut(s) 615
XapI RAATTY 2 cut(s) 393, 849
XmiI GTMKAC 1 cut(s) 569
XspI CTAG 5 cut(s) 66, 75, 302, 465, 477
ZrmI AGTACT 3 cut(s) 410, 469, 737
Zsp2I ATGCAT 1 cut(s) 424
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.