Rmu_sc0033849.1_g000001

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033849.1
Physical Location & Seq
Forward (+)
1 .. 1595
1595 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033849.1_g000001.1.cds

Sequence Viewer

Length: 1038 bp
tggaaagtccatcttctcaactggaatgctatgtgtaaacctaagagtgatggtagtctagggattaagacatctgcaagcatgaatcaagctatgcttgctaaagccaactggaggattttacagggtgataaaggtttatggtgcagaatttacaaggacaagtacttgcgtaatgcatcgctgttgtctcttacatatgaaaagcctaagaattgctctagtacttggtctagtgtagtctttggtgctaatttattgaagcttggtcttcgctggagagtgggaagtggaactcaaattaacttctggaatgacagttggtctacagctggagcccttagacatttcgttacggacactaaccttattaatgatagtgctactgttgatgattttttgcaggatggtcattggaatattgatttgctcaaaacttgtctttcgtctcaaattattgataccatcacttgtattcctgtgtccatagagttctcaaatgataaactcatttggggtggtactaccaatggtgttttctcagtgaattgttggttcatatggaaatggaggagtaaaagaatctttgaaccatcttttcatatcccttacaatatccctgatgttgtcctgagctatgcaacagattggaaaaatgcaacttgtaaaattgcaactcagaaaactaaacagatagagatgatctcaaggtgtaaacctggcttaggtttctttaagctaaatgtggatggttccaggtcttctaatgttcagctgctccaatctgatgctattgagttgcatcctcttggtactatcctcatgaattgcaagctgttaatgaaccaatttgatacctgccagatgaggcatatccacagagaaggtaatatggttgctgatatccttgctaaagaaagtattcttcactctgctggcctttgtactttcaattctcctcatgctctagttgttgaagctatccttgatgatatcttgggtgttgttagacctagggaagttgttaacaatggttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

345

Amino Acids

38.9

Weight (kDa)

8.91

Isoelectric Point (pI)

35.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 866
AccI GTMKAC 1 cut(s) 326
AcsI RAATTY 1 cut(s) 150
AfaI GTAC 5 cut(s) 167, 226, 523, 814, 946
AfiI CCNNNNNNNGG 2 cut(s) 114, 725
AgsI TTSAA 4 cut(s) 262, 590, 952, 977
AhdI GACNNNNNGTC 1 cut(s) 322
AjnI CCWGG 2 cut(s) 718, 755
AjuI GAANNNNNNNTTGG 2 cut(s) 521, 553
AluBI AGCT 8 cut(s) 92, 265, 332, 636, 739, 775, 835, 980
AluI AGCT 8 cut(s) 92, 265, 332, 636, 739, 775, 835, 980
Alw26I GTCTC 2 cut(s) 195, 453
AoxI GGCC 1 cut(s) 937
ApeKI GCWGC 1 cut(s) 775
ApoI RAATTY 1 cut(s) 150
AseI ATTAAT 1 cut(s) 372
Asp700I GAANNNNTTC 1 cut(s) 921
AspA2I CCTAGG 1 cut(s) 1013
AsuHPI GGTGA 1 cut(s) 140
AvrII CCTAGG 1 cut(s) 1013
BanII GRGCYC 1 cut(s) 340
BbsI GAAGAC 2 cut(s) 263, 753
BbvI GCAGC 1 cut(s) 762
BccI CCATC 6 cut(s) 18, 44, 401, 473, 601, 743
BciT130I CCWGG 2 cut(s) 720, 757
BcoDI GTCTC 2 cut(s) 195, 453
BfaI CTAG 5 cut(s) 59, 222, 234, 968, 1014
BfmI CTRYAG 1 cut(s) 327
BfuAI ACCTGC 1 cut(s) 866
BisI GCNGC 1 cut(s) 776
BlnI CCTAGG 1 cut(s) 1013
BlsI GCNGC 1 cut(s) 777
BmcAI AGTACT 2 cut(s) 167, 226
Bme1390I CCNGG 2 cut(s) 720, 757
BmeRI GACNNNNNGTC 1 cut(s) 322
BmiI GGNNCC 2 cut(s) 337, 754
BmrFI CCNGG 2 cut(s) 720, 757
BmsI GCATC 3 cut(s) 188, 778, 811
BpiI GAAGAC 2 cut(s) 263, 753
BplI GAGNNNNNCTC 2 cut(s) 689, 721
BpmI CTGGAG 3 cut(s) 133, 298, 354
Bpu10I CCTNAGC 2 cut(s) 632, 724
BpuEI CTTGAG 1 cut(s) 691
BsaJI CCNNGG 1 cut(s) 1013
Bsc4I CCNNNNNNNGG 2 cut(s) 114, 725
Bse1I ACTGG 2 cut(s) 26, 116
BseBI CCWGG 2 cut(s) 720, 757
BseDI CCNNGG 1 cut(s) 1013
BseGI GGATG 3 cut(s) 412, 754, 802
BseLI CCNNNNNNNGG 2 cut(s) 114, 725
BseMII CTCAG 3 cut(s) 555, 623, 692
BseNI ACTGG 2 cut(s) 26, 116
BseRI GAGGAG 2 cut(s) 586, 948
BseXI GCAGC 1 cut(s) 762
BsgI GTGCAG 1 cut(s) 166
BshFI GGCC 1 cut(s) 939
BslI CCNNNNNNNGG 2 cut(s) 114, 725
BsmAI GTCTC 2 cut(s) 195, 453
BsmBI CGTCTC 1 cut(s) 453
BsmI GAATGC 1 cut(s) 31
BsnI GGCC 1 cut(s) 939
Bsp1286I GDGCHC 1 cut(s) 340
Bsp143I GATC 1 cut(s) 702
BspANI GGCC 1 cut(s) 939
BspCNI CTCAG 3 cut(s) 554, 624, 691
BspHI TCATGA 1 cut(s) 822
BspLI GGNNCC 2 cut(s) 337, 754
BspMI ACCTGC 1 cut(s) 866
BsrI ACTGG 2 cut(s) 26, 116
BssECI CCNNGG 1 cut(s) 1013
BssMI GATC 1 cut(s) 702
BssT1I CCWWGG 1 cut(s) 1013
Bst2UI CCWGG 2 cut(s) 720, 757
Bst4CI ACNGT 2 cut(s) 320, 388
BstC8I GCNNGC 4 cut(s) 79, 99, 833, 937
BstDEI CTNAG 7 cut(s) 42, 210, 341, 541, 632, 678, 724
BstENI CCTNNNNNAGG 1 cut(s) 723
BstF5I GGATG 3 cut(s) 412, 754, 802
BstKTI GATC 1 cut(s) 705
BstMAI GTCTC 2 cut(s) 195, 453
BstMBI GATC 1 cut(s) 702
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstNI CCWGG 2 cut(s) 720, 757
BstSCI CCNGG 2 cut(s) 718, 755
BstSFI CTRYAG 1 cut(s) 327
BstV1I GCAGC 1 cut(s) 762
BstV2I GAAGAC 2 cut(s) 263, 753
BsuRI GGCC 1 cut(s) 939
BtgZI GCGATG 1 cut(s) 165
BtsCI GGATG 3 cut(s) 412, 754, 802
BtsIMutI CAGTG 1 cut(s) 549
BveI ACCTGC 1 cut(s) 866
Cac8I GCNNGC 4 cut(s) 79, 99, 833, 937
CciI TCATGA 1 cut(s) 822
Csp6I GTAC 5 cut(s) 166, 225, 522, 813, 945
CviAII CATG 3 cut(s) 82, 823, 962
CviQI GTAC 5 cut(s) 166, 225, 522, 813, 945
DdeI CTNAG 7 cut(s) 42, 210, 341, 541, 632, 678, 724
DpnI GATC 1 cut(s) 704
DpnII GATC 1 cut(s) 702
DriI GACNNNNNGTC 1 cut(s) 322
Eam1105I GACNNNNNGTC 1 cut(s) 322
Eco130I CCWWGG 1 cut(s) 1013
Eco24I GRGCYC 1 cut(s) 340
Eco32I GATATC 2 cut(s) 904, 994
EcoNI CCTNNNNNAGG 1 cut(s) 723
EcoRII CCWGG 2 cut(s) 718, 755
EcoRV GATATC 2 cut(s) 904, 994
EcoT14I CCWWGG 1 cut(s) 1013
EcoT22I ATGCAT 1 cut(s) 181
EcoT38I GRGCYC 1 cut(s) 340
ErhI CCWWGG 1 cut(s) 1013
Esp3I CGTCTC 1 cut(s) 453
FaeI CATG 3 cut(s) 85, 826, 965
FalI AAGNNNNNCTT 5 cut(s) 29, 81, 113, 969, 1001
FatI CATG 3 cut(s) 81, 822, 961
FauNDI CATATG 2 cut(s) 199, 560
FblI GTMKAC 1 cut(s) 326
Fnu4HI GCNGC 1 cut(s) 776
FokI GGATG 3 cut(s) 419, 761, 789
FriOI GRGCYC 1 cut(s) 340
Fsp4HI GCNGC 1 cut(s) 776
FspBI CTAG 5 cut(s) 59, 222, 234, 968, 1014
GluI GCNGC 1 cut(s) 776
GsuI CTGGAG 3 cut(s) 133, 298, 354
HaeIII GGCC 1 cut(s) 939
Hin1II CATG 3 cut(s) 85, 826, 965
HincII GTYRAC 1 cut(s) 1027
HindII GTYRAC 1 cut(s) 1027
HindIII AAGCTT 1 cut(s) 263
HinfI GANTC 2 cut(s) 85, 582
HpaI GTTAAC 1 cut(s) 1027
HphI GGTGA 1 cut(s) 140
Hpy166II GTNNAC 4 cut(s) 38, 327, 716, 1027
Hpy188I TCNGA 2 cut(s) 681, 787
Hpy188III TCNNGA 3 cut(s) 310, 631, 823
Hpy8I GTNNAC 4 cut(s) 38, 327, 716, 1027
HpyAV CCTTC 1 cut(s) 878
HpyCH4III ACNGT 2 cut(s) 320, 388
HpyCH4V TGCA 9 cut(s) 77, 147, 179, 403, 641, 659, 674, 802, 831
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
HpyF3I CTNAG 7 cut(s) 42, 210, 341, 541, 632, 678, 724
Hsp92II CATG 3 cut(s) 85, 826, 965
KspAI GTTAAC 1 cut(s) 1027
Kzo9I GATC 1 cut(s) 702
LmnI GCTCC 2 cut(s) 335, 783
Lsp1109I GCAGC 1 cut(s) 762
LweI GCATC 3 cut(s) 188, 778, 811
MaeI CTAG 5 cut(s) 59, 222, 234, 968, 1014
MaeIII GTNAC 1 cut(s) 352
MalI GATC 1 cut(s) 704
MboI GATC 1 cut(s) 702
MboII GAAGA 4 cut(s) 5, 263, 753, 917
MhlI GDGCHC 1 cut(s) 340
MnlI CCTC 6 cut(s) 108, 564, 816, 830, 861, 969
Mph1103I ATGCAT 1 cut(s) 181
MroXI GAANNNNTTC 1 cut(s) 921
MseI TTAA 6 cut(s) 66, 303, 372, 735, 839, 1026
MspA1I CMGCKG 2 cut(s) 332, 775
MspR9I CCNGG 2 cut(s) 720, 757
Mva1269I GAATGC 1 cut(s) 31
MvaI CCWGG 2 cut(s) 720, 757
MwoI GCNNNNNNNGC 1 cut(s) 98
NdeI CATATG 2 cut(s) 199, 560
NdeII GATC 1 cut(s) 702
NlaIII CATG 3 cut(s) 85, 826, 965
NlaIV GGNNCC 2 cut(s) 337, 754
NsiI ATGCAT 1 cut(s) 181
PagI TCATGA 1 cut(s) 822
PctI GAATGC 1 cut(s) 31
PdmI GAANNNNTTC 1 cut(s) 921
PfeI GAWTC 2 cut(s) 85, 582
PkrI GCNGC 1 cut(s) 777
PshBI ATTAAT 1 cut(s) 372
Psp6I CCWGG 2 cut(s) 718, 755
PspGI CCWGG 2 cut(s) 718, 755
PspN4I GGNNCC 2 cut(s) 337, 754
PvuII CAGCTG 2 cut(s) 332, 775
RsaI GTAC 5 cut(s) 167, 226, 523, 814, 946
RsaNI GTAC 5 cut(s) 166, 225, 522, 813, 945
SaqAI TTAA 6 cut(s) 66, 303, 372, 735, 839, 1026
SatI GCNGC 1 cut(s) 776
Sau3AI GATC 1 cut(s) 702
ScaI AGTACT 2 cut(s) 167, 226
ScrFI CCNGG 2 cut(s) 720, 757
SduI GDGCHC 1 cut(s) 340
SfaNI GCATC 3 cut(s) 188, 778, 811
SfcI CTRYAG 1 cut(s) 327
SmlI CTYRAG 1 cut(s) 706
SmoI CTYRAG 1 cut(s) 706
SspI AATATT 1 cut(s) 421
SspMI CTAG 5 cut(s) 59, 222, 234, 968, 1014
StyD4I CCNGG 2 cut(s) 718, 755
StyI CCWWGG 1 cut(s) 1013
TaaI ACNGT 2 cut(s) 320, 388
TatI WGTACW 3 cut(s) 165, 224, 944
TfiI GAWTC 2 cut(s) 85, 582
Tru1I TTAA 6 cut(s) 66, 303, 372, 735, 839, 1026
Tru9I TTAA 6 cut(s) 66, 303, 372, 735, 839, 1026
TscAI CASTG 1 cut(s) 549
TseI GCWGC 1 cut(s) 775
TspDTI ATGAA 6 cut(s) 98, 216, 547, 590, 839, 857
TspGWI ACGGA 1 cut(s) 371
TspRI CASTG 1 cut(s) 549
VspI ATTAAT 1 cut(s) 372
XagI CCTNNNNNAGG 1 cut(s) 723
XapI RAATTY 1 cut(s) 150
XmaJI CCTAGG 1 cut(s) 1013
XmiI GTMKAC 1 cut(s) 326
XmnI GAANNNNTTC 1 cut(s) 921
XspI CTAG 5 cut(s) 59, 222, 234, 968, 1014
ZrmI AGTACT 2 cut(s) 167, 226
Zsp2I ATGCAT 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.