Rmu_sc0006862.1_g000009

Ribonuclease H

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006862.1
Physical Location & Seq
Forward (+)
34662 .. 35674
1013 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006862.1_g000009.1.cds

Sequence Viewer

Length: 798 bp
atgcttgcaaaagctggatggagactccacaataatgattctggattgtgggctacaatttacagggaaaaataccttcgtagtgccaatcttgttgatgactcttatgttgtccccaaggattgttccagtacatggagaagtattgttcatggggctaatcttcttaaacaaggcttgacctggagagttggagatggaagacgaattaatttctggttcgatatgtggctgcctcttttttcccttcataatcatattcttccttctgcctcctttaatcctactgataaaatttctaacttttgggatgaccatggttgggacattgataaattaactgcttgtcttcctcaacatattatcgaccagattattcgtattcctcctggctttgatgggtatggagaagataaacaaatttgggggtatacatctaatggtatctttagtgtaaagtctgcttatgctatttttcttgcatcctattgtcaggataactctccatggaaattcatttggaaattgcagcttcctcccaaattgaagacattcacatggattgttttccatggcaaactcttaacaaatgttcaaagagccaaaaggaatttgaccaatgacaactgttgtcctttatgccatcaagctcttgagactcttgctcacctatttcgagattgccctgctgctcaattgatatggaattctttcaatataccatcttgcgtggctaatacttttcagataagttggaatggttggcttatggctcatcttctgtgcaagacctcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

265

Amino Acids

30.59

Weight (kDa)

8.83

Isoelectric Point (pI)

38.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 135
AccI GTMKAC 1 cut(s) 431
AcsI RAATTY 5 cut(s) 294, 420, 512, 610, 706
AfaI GTAC 1 cut(s) 133
AfiI CCNNNNNNNGG 2 cut(s) 135, 322
AgsI TTSAA 3 cut(s) 547, 596, 715
AjnI CCWGG 2 cut(s) 182, 388
AluBI AGCT 3 cut(s) 14, 532, 650
AluI AGCT 3 cut(s) 14, 532, 650
Alw26I GTCTC 2 cut(s) 16, 650
ApeKI GCWGC 3 cut(s) 232, 529, 689
ApoI RAATTY 5 cut(s) 294, 420, 512, 610, 706
AseI ATTAAT 1 cut(s) 210
Asp700I GAANNNNTTC 2 cut(s) 551, 710
AsuHPI GGTGA 1 cut(s) 659
BbsI GAAGAC 3 cut(s) 208, 341, 554
BbvI GCAGC 3 cut(s) 219, 541, 676
BccI CCATC 5 cut(s) 12, 191, 392, 651, 730
BciT130I CCWGG 2 cut(s) 184, 390
BcoDI GTCTC 2 cut(s) 16, 650
BfaI CTAG 1 cut(s) 796
BisI GCNGC 3 cut(s) 233, 530, 690
BlsI GCNGC 3 cut(s) 234, 531, 691
Bme1390I CCNGG 2 cut(s) 184, 390
BmrFI CCNGG 2 cut(s) 184, 390
BmsI GCATC 1 cut(s) 491
BpiI GAAGAC 3 cut(s) 208, 341, 554
BpmI CTGGAG 1 cut(s) 205
BpuEI CTTGAG 1 cut(s) 674
BsaJI CCNNGG 4 cut(s) 117, 316, 506, 571
Bsc4I CCNNNNNNNGG 2 cut(s) 135, 322
Bse1I ACTGG 1 cut(s) 129
BseBI CCWGG 2 cut(s) 184, 390
BseDI CCNNGG 4 cut(s) 117, 316, 506, 571
BseGI GGATG 3 cut(s) 23, 316, 482
BseLI CCNNNNNNNGG 2 cut(s) 135, 322
BseNI ACTGG 1 cut(s) 129
BseXI GCAGC 3 cut(s) 219, 541, 676
BslFI GGGAC 2 cut(s) 98, 338
BslI CCNNNNNNNGG 2 cut(s) 135, 322
BsmAI GTCTC 2 cut(s) 16, 650
BsmFI GGGAC 2 cut(s) 98, 338
Bsp19I CCATGG 3 cut(s) 316, 506, 571
BsrI ACTGG 1 cut(s) 129
BssECI CCNNGG 4 cut(s) 117, 316, 506, 571
BssNAI GTATAC 1 cut(s) 432
BssT1I CCWWGG 4 cut(s) 117, 316, 506, 571
Bst1107I GTATAC 1 cut(s) 432
Bst2UI CCWGG 2 cut(s) 184, 390
Bst4CI ACNGT 1 cut(s) 629
BstC8I GCNNGC 1 cut(s) 6
BstDSI CCRYGG 3 cut(s) 316, 506, 571
BstF5I GGATG 3 cut(s) 23, 316, 482
BstMAI GTCTC 2 cut(s) 16, 650
BstNI CCWGG 2 cut(s) 184, 390
BstSCI CCNGG 2 cut(s) 182, 388
BstV1I GCAGC 3 cut(s) 219, 541, 676
BstV2I GAAGAC 3 cut(s) 208, 341, 554
BstZ17I GTATAC 1 cut(s) 432
BtgI CCRYGG 3 cut(s) 316, 506, 571
BtsCI GGATG 3 cut(s) 23, 316, 482
Cac8I GCNNGC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 132
CviAII CATG 6 cut(s) 135, 152, 317, 507, 558, 572
CviQI GTAC 1 cut(s) 132
Eco130I CCWWGG 4 cut(s) 117, 316, 506, 571
EcoRI GAATTC 1 cut(s) 706
EcoRII CCWGG 2 cut(s) 182, 388
EcoT14I CCWWGG 4 cut(s) 117, 316, 506, 571
ErhI CCWWGG 4 cut(s) 117, 316, 506, 571
FaeI CATG 6 cut(s) 138, 155, 320, 510, 561, 575
FaqI GGGAC 2 cut(s) 98, 338
FatI CATG 6 cut(s) 134, 151, 316, 506, 557, 571
FblI GTMKAC 1 cut(s) 431
Fnu4HI GCNGC 3 cut(s) 233, 530, 690
FokI GGATG 3 cut(s) 30, 323, 469
Fsp4HI GCNGC 3 cut(s) 233, 530, 690
FspBI CTAG 1 cut(s) 796
GluI GCNGC 3 cut(s) 233, 530, 690
GsuI CTGGAG 1 cut(s) 205
Hin1II CATG 6 cut(s) 138, 155, 320, 510, 561, 575
HinfI GANTC 4 cut(s) 24, 38, 101, 658
HphI GGTGA 1 cut(s) 659
Hpy166II GTNNAC 1 cut(s) 432
Hpy188I TCNGA 1 cut(s) 747
Hpy188III TCNNGA 4 cut(s) 42, 494, 653, 677
Hpy8I GTNNAC 1 cut(s) 432
HpyAV CCTTC 3 cut(s) 86, 257, 276
HpyCH4III ACNGT 1 cut(s) 629
HpyCH4V TGCA 4 cut(s) 8, 482, 529, 786
Hsp92II CATG 6 cut(s) 138, 155, 320, 510, 561, 575
Lsp1109I GCAGC 3 cut(s) 219, 541, 676
LweI GCATC 1 cut(s) 491
MaeI CTAG 1 cut(s) 796
MboII GAAGA 7 cut(s) 155, 213, 254, 341, 422, 559, 770
MfeI CAATTG 1 cut(s) 695
MlyI GAGTC 3 cut(s) 18, 95, 652
MmeI TCCRAC 2 cut(s) 172, 734
MnlI CCTC 5 cut(s) 246, 283, 363, 396, 546
MroXI GAANNNNTTC 2 cut(s) 551, 710
MseI TTAA 5 cut(s) 168, 210, 279, 338, 584
MslI CAYNNNNRTG 2 cut(s) 33, 556
MspR9I CCNGG 2 cut(s) 184, 390
MunI CAATTG 1 cut(s) 695
MvaI CCWGG 2 cut(s) 184, 390
NcoI CCATGG 3 cut(s) 316, 506, 571
NlaIII CATG 6 cut(s) 138, 155, 320, 510, 561, 575
PdmI GAANNNNTTC 2 cut(s) 551, 710
PfeI GAWTC 1 cut(s) 38
PflMI CCANNNNNTGG 1 cut(s) 135
PkrI GCNGC 3 cut(s) 234, 531, 691
PleI GAGTC 3 cut(s) 18, 95, 652
PpsI GAGTC 3 cut(s) 18, 95, 652
PshBI ATTAAT 1 cut(s) 210
Psp6I CCWGG 2 cut(s) 182, 388
PspGI CCWGG 2 cut(s) 182, 388
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
RseI CAYNNNNRTG 2 cut(s) 33, 556
SaqAI TTAA 5 cut(s) 168, 210, 279, 338, 584
SatI GCNGC 3 cut(s) 233, 530, 690
SchI GAGTC 3 cut(s) 18, 95, 652
ScrFI CCNGG 2 cut(s) 184, 390
SetI ASST 7 cut(s) 16, 78, 185, 534, 652, 672, 794
SfaNI GCATC 1 cut(s) 491
SmiMI CAYNNNNRTG 2 cut(s) 33, 556
SmlI CTYRAG 1 cut(s) 653
SmoI CTYRAG 1 cut(s) 653
SspMI CTAG 1 cut(s) 796
StyD4I CCNGG 2 cut(s) 182, 388
StyI CCWWGG 4 cut(s) 117, 316, 506, 571
TaaI ACNGT 1 cut(s) 629
TaqI TCGA 3 cut(s) 222, 366, 676
TatI WGTACW 1 cut(s) 131
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 5 cut(s) 168, 210, 279, 338, 584
Tru9I TTAA 5 cut(s) 168, 210, 279, 338, 584
TseI GCWGC 3 cut(s) 232, 529, 689
TspDTI ATGAA 3 cut(s) 140, 239, 505
Van91I CCANNNNNTGG 1 cut(s) 135
VspI ATTAAT 1 cut(s) 210
XapI RAATTY 5 cut(s) 294, 420, 512, 610, 706
XmiI GTMKAC 1 cut(s) 431
XmnI GAANNNNTTC 2 cut(s) 551, 710
XspI CTAG 1 cut(s) 796
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.