Rmu_sc0004200.1_g000003

Ribonuclease H

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004200.1
Physical Location & Seq
Forward (+)
5125 .. 5721
597 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004200.1_g000003.1.cds

Sequence Viewer

Length: 597 bp
atgctagcaaagtctagctggagaattctcaataatgattctgggttgtggcccaacatatacaaagaaaaatatcttcgcaaatgcactttgactgctactaactatcaaatccccaaggattgttctaatacctggaggagcattgttcatggtgctgctttgctgaaacgtggccttgtttggagggtgggaaatggaaaaaaaattaacttttggtctgatgtttggttacctccaaagcctcttattaaccatgttctaccttctgcatctttcattttggatgataagattgagagcttttgggatgatcatggctggaacctcaccaaactctctacttgtctccctcagaccatcattgatcaaattatgcatattccttccggctttgatggttgcggtgtagatgtccagatttgggggtacacttcctgtggttatttcagtgtcaaatctacttatggtatgttctttgattctcattgtcatactacttctccatggaaattcatatggaaaatgcatttaattcaaagggaacttgggctattccatgtccttgaattaatattaatggcccagtcgtcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

198

Amino Acids

22.85

Weight (kDa)

8.88

Isoelectric Point (pI)

45.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 405
AcsI RAATTY 2 cut(s) 24, 512
AfaI GTAC 1 cut(s) 431
AfiI CCNNNNNNNGG 1 cut(s) 424
AgsI TTSAA 2 cut(s) 539, 569
AjnI CCWGG 1 cut(s) 134
AluBI AGCT 2 cut(s) 18, 303
AluI AGCT 2 cut(s) 18, 303
Alw26I GTCTC 1 cut(s) 353
AoxI GGCC 3 cut(s) 50, 175, 582
ApeKI GCWGC 1 cut(s) 158
ApoI RAATTY 2 cut(s) 24, 512
AseI ATTAAT 2 cut(s) 572, 578
AspS9I GGNCC 2 cut(s) 51, 583
AsuHPI GGTGA 1 cut(s) 322
AsuNHI GCTAGC 1 cut(s) 4
BbvI GCAGC 1 cut(s) 145
BccI CCATC 2 cut(s) 368, 392
BciT130I CCWGG 1 cut(s) 136
BclI TGATCA 2 cut(s) 313, 367
BcoDI GTCTC 1 cut(s) 353
BfaI CTAG 2 cut(s) 5, 15
BisI GCNGC 1 cut(s) 159
BlsI GCNGC 1 cut(s) 160
Bme1390I CCNGG 1 cut(s) 136
BmgT120I GGNCC 2 cut(s) 51, 583
BmiI GGNNCC 1 cut(s) 326
BmrFI CCNGG 1 cut(s) 136
BmrI ACTGGG 1 cut(s) 580
BmsI GCATC 1 cut(s) 281
BmtI GCTAGC 1 cut(s) 8
BmuI ACTGGG 1 cut(s) 580
BpmI CTGGAG 2 cut(s) 40, 157
BsaJI CCNNGG 2 cut(s) 117, 506
BsaXI ACNNNNNCTCC 2 cut(s) 487, 517
Bsc4I CCNNNNNNNGG 1 cut(s) 424
Bse1I ACTGG 1 cut(s) 586
BseBI CCWGG 1 cut(s) 136
BseDI CCNNGG 2 cut(s) 117, 506
BseGI GGATG 2 cut(s) 292, 316
BseLI CCNNNNNNNGG 1 cut(s) 424
BseMII CTCAG 1 cut(s) 368
BseNI ACTGG 1 cut(s) 586
BseRI GAGGAG 1 cut(s) 154
BseXI GCAGC 1 cut(s) 145
BshFI GGCC 3 cut(s) 52, 177, 584
BsiSI CCGG 1 cut(s) 390
BslI CCNNNNNNNGG 1 cut(s) 424
BsmAI GTCTC 1 cut(s) 353
BsnI GGCC 3 cut(s) 52, 177, 584
Bsp143I GATC 2 cut(s) 313, 367
Bsp19I CCATGG 1 cut(s) 506
BspACI CCGC 1 cut(s) 405
BspANI GGCC 3 cut(s) 52, 177, 584
BspCNI CTCAG 1 cut(s) 367
BspLI GGNNCC 1 cut(s) 326
BspOI GCTAGC 1 cut(s) 8
BsrI ACTGG 1 cut(s) 586
BssECI CCNNGG 2 cut(s) 117, 506
BssMI GATC 2 cut(s) 313, 367
BssT1I CCWWGG 2 cut(s) 117, 506
Bst2UI CCWGG 1 cut(s) 136
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 354
BstDSI CCRYGG 1 cut(s) 506
BstEII GGTNACC 1 cut(s) 231
BstF5I GGATG 2 cut(s) 292, 316
BstKTI GATC 2 cut(s) 316, 370
BstMAI GTCTC 1 cut(s) 353
BstMBI GATC 2 cut(s) 313, 367
BstNI CCWGG 1 cut(s) 136
BstPI GGTNACC 1 cut(s) 231
BstSCI CCNGG 1 cut(s) 134
BstV1I GCAGC 1 cut(s) 145
BsuRI GGCC 3 cut(s) 52, 177, 584
BtgI CCRYGG 1 cut(s) 506
BtsCI GGATG 2 cut(s) 292, 316
BtsIMutI CAGTG 1 cut(s) 457
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 2 cut(s) 51, 583
Csp6I GTAC 1 cut(s) 430
CviAII CATG 5 cut(s) 152, 257, 317, 507, 560
CviJI RGCY 9 cut(s) 18, 52, 177, 244, 303, 321, 393, 553, 584
CviKI_1 RGCY 9 cut(s) 18, 52, 177, 244, 303, 321, 393, 553, 584
CviQI GTAC 1 cut(s) 430
DdeI CTNAG 1 cut(s) 354
DpnI GATC 2 cut(s) 315, 369
DpnII GATC 2 cut(s) 313, 367
Eco130I CCWWGG 2 cut(s) 117, 506
Eco91I GGTNACC 1 cut(s) 231
EcoO65I GGTNACC 1 cut(s) 231
EcoRI GAATTC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 134
EcoT14I CCWWGG 2 cut(s) 117, 506
EcoT22I ATGCAT 2 cut(s) 381, 531
ErhI CCWWGG 2 cut(s) 117, 506
FaeI CATG 5 cut(s) 155, 260, 320, 510, 563
FatI CATG 5 cut(s) 151, 256, 316, 506, 559
FauNDI CATATG 1 cut(s) 518
FbaI TGATCA 2 cut(s) 313, 367
Fnu4HI GCNGC 1 cut(s) 159
FokI GGATG 2 cut(s) 299, 323
Fsp4HI GCNGC 1 cut(s) 159
FspBI CTAG 2 cut(s) 5, 15
GluI GCNGC 1 cut(s) 159
GsuI CTGGAG 2 cut(s) 40, 157
HaeIII GGCC 3 cut(s) 52, 177, 584
HapII CCGG 1 cut(s) 390
Hin1II CATG 5 cut(s) 155, 260, 320, 510, 563
HinfI GANTC 2 cut(s) 38, 482
HpaII CCGG 1 cut(s) 390
HphI GGTGA 1 cut(s) 322
Hpy166II GTNNAC 1 cut(s) 432
Hpy188I TCNGA 2 cut(s) 223, 357
Hpy188III TCNNGA 1 cut(s) 418
Hpy8I GTNNAC 1 cut(s) 432
Hpy99I CGWCG 1 cut(s) 595
HpyAV CCTTC 2 cut(s) 276, 396
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 4 cut(s) 87, 272, 379, 529
HpyF3I CTNAG 1 cut(s) 354
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 5 cut(s) 155, 260, 320, 510, 563
Ksp22I TGATCA 2 cut(s) 313, 367
Kzo9I GATC 2 cut(s) 313, 367
LmnI GCTCC 1 cut(s) 141
LpnPI CCDG 8 cut(s) 4, 27, 121, 148, 307, 403, 431, 451
Lsp1109I GCAGC 1 cut(s) 145
LweI GCATC 1 cut(s) 281
MaeI CTAG 2 cut(s) 5, 15
MaeII ACGT 1 cut(s) 172
MaeIII GTNAC 1 cut(s) 231
MalI GATC 2 cut(s) 315, 369
MboI GATC 2 cut(s) 313, 367
MboII GAAGA 1 cut(s) 68
MluCI AATT 6 cut(s) 24, 207, 372, 512, 534, 569
MnlI CCTC 6 cut(s) 132, 180, 246, 255, 338, 363
Mph1103I ATGCAT 2 cut(s) 381, 531
MseI TTAA 5 cut(s) 210, 252, 533, 572, 578
MspI CCGG 1 cut(s) 390
MspR9I CCNGG 1 cut(s) 136
MvaI CCWGG 1 cut(s) 136
NcoI CCATGG 1 cut(s) 506
NdeI CATATG 1 cut(s) 518
NdeII GATC 2 cut(s) 313, 367
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 5 cut(s) 155, 260, 320, 510, 563
NlaIV GGNNCC 1 cut(s) 326
NsiI ATGCAT 2 cut(s) 381, 531
PfeI GAWTC 2 cut(s) 38, 482
PkrI GCNGC 1 cut(s) 160
PshBI ATTAAT 2 cut(s) 572, 578
Psp6I CCWGG 1 cut(s) 134
PspEI GGTNACC 1 cut(s) 231
PspGI CCWGG 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 326
PspPI GGNCC 2 cut(s) 51, 583
RsaI GTAC 1 cut(s) 431
RsaNI GTAC 1 cut(s) 430
SaqAI TTAA 5 cut(s) 210, 252, 533, 572, 578
SatI GCNGC 1 cut(s) 159
Sau3AI GATC 2 cut(s) 313, 367
Sau96I GGNCC 2 cut(s) 51, 583
ScrFI CCNGG 1 cut(s) 136
SetI ASST 7 cut(s) 20, 137, 175, 238, 268, 305, 330
SfaNI GCATC 1 cut(s) 281
Sse9I AATT 6 cut(s) 24, 207, 372, 512, 534, 569
SsiI CCGC 1 cut(s) 405
SspI AATATT 1 cut(s) 576
SspMI CTAG 2 cut(s) 5, 15
StyD4I CCNGG 1 cut(s) 134
StyI CCWWGG 2 cut(s) 117, 506
TaiI ACGT 1 cut(s) 175
TasI AATT 6 cut(s) 24, 207, 372, 512, 534, 569
TfiI GAWTC 2 cut(s) 38, 482
Tru1I TTAA 5 cut(s) 210, 252, 533, 572, 578
Tru9I TTAA 5 cut(s) 210, 252, 533, 572, 578
TscAI CASTG 1 cut(s) 457
TseI GCWGC 1 cut(s) 158
TspDTI ATGAA 3 cut(s) 140, 268, 505
TspRI CASTG 1 cut(s) 457
VspI ATTAAT 2 cut(s) 572, 578
XapI RAATTY 2 cut(s) 24, 512
XspI CTAG 2 cut(s) 5, 15
Zsp2I ATGCAT 2 cut(s) 381, 531
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.