Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004175.1

Orthogroup ID

OG0001772

Physical Location & Seq

Genomic Coordinates Reverse (-)

13355 .. 14101

Gene Structure 747 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004175.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 747 bp

atggctggtaggctcactcttataaattctgtgtgctctgccattctggtttatgctatgcaaactatgaagctacttatatctctatgtgattctttggataaattaaacagggactttctttgggttgattctaaagctaagaaaagtgtgcatctagccaattgggatatggtttgtcgtcctaaggagtatggtggcttgggaatcaagagtacttcgcaaatgaatcaagctcttcttgcaaaacttaggtggagattaactcaaggagataatggattgtggagtaaggttctccatcagaagtatgtgaagactaattcattacttcattctcagtatctgtgcccttctaggtgttctagtacatggagaagtgtcctttttggtactaaattgcttaagcagggattgtcatggaggattggtgatggtaataatgtgaatttttggaccgacatttggattccaggtggacctttgattaaggatgctgtaagccttggaaatgttgatttgaatctgaaggtgaaggatttttggcacggtgctagttggaacctagatttgataagacaatgtgtgagtgaggagtccattagcgaaattatccaagtccttgctggtttccttggtggtggacatgataaattgatctggggggcaacttcaaatggtaatttcactgttaaatctgcctaccttactcttataaaggacaaaaattttgatagttatccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

248

Amino Acids

27.83

Weight (kDa)

9.36

Isoelectric Point (pI)

19.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001772)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g04886 FvH4_2g12003 FvH4_5g27492
rosa_chinensis	RchiOBHm_Chr1g0382551 RchiOBHm_Chr1g0384551
rosa_laevigata	RLG00000002160
rosa_multiflora	Rmu_co8264107.1_g000001 Rmu_co8333359.1_g000001 Rmu_sc0000295.1_g000023 Rmu_sc0000657.1_g000002 Rmu_sc0000935.1_g000036 Rmu_sc0001150.1_g000003 Rmu_sc0001484.1_g000025 Rmu_sc0001512.1_g000020 Rmu_sc0001618.1_g000002 Rmu_sc0001809.1_g000022 Rmu_sc0002354.1_g000044 Rmu_sc0002522.1_g000061 Rmu_sc0004175.1_g000004 Rmu_sc0004200.1_g000003 Rmu_sc0004569.1_g000010 Rmu_sc0005950.1_g000002 Rmu_sc0006862.1_g000009 Rmu_sc0007977.1_g000017 Rmu_sc0008049.1_g000020 Rmu_sc0008752.1_g000003 Rmu_sc0009440.1_g000002 Rmu_sc0009969.1_g000003 Rmu_sc0010108.1_g000001 Rmu_sc0010822.1_g000003 Rmu_sc0010883.1_g000006 Rmu_sc0017237.1_g000001 Rmu_sc0018807.1_g000013 Rmu_sc0027036.1_g000002 Rmu_sc0033849.1_g000001 Rmu_ssc0000387.1_g000008
rosa_roxburghii	Rroxscaffold_2G00087680 Rroxscaffold_3G00224640 Rroxscaffold_7G00179230
rosa_rugosa	Rorug01G0040100 Rorug01G0390700 Rorug02G0557500 Rorug03G0004200 Rorug04G0040100 Rorug07G0095000 Rorug07G0277300
rosa_samantha	Rh5BG202500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	23, 716
AcsI	RAATTY	3 cut(s)	25, 448, 727
AcuI	CTGAAG	1 cut(s)	548
AfaI	GTAC	3 cut(s)	217, 370, 394
AfiI	CCNNNNNNNGG	1 cut(s)	465
AflII	CTTAAG	1 cut(s)	404
AgsI	TTSAA	2 cut(s)	523, 675
AjnI	CCWGG	1 cut(s)	472
AluBI	AGCT	3 cut(s)	73, 140, 236
AluI	AGCT	3 cut(s)	73, 140, 236
Alw21I	GWGCWC	1 cut(s)	38
AlwNI	CAGNNNCTG	1 cut(s)	346
ApoI	RAATTY	3 cut(s)	25, 448, 727
ArsI	GACNNNNNNTTYG	2 cut(s)	713, 745
AspS9I	GGNCC	2 cut(s)	456, 479
AsuHPI	GGTGA	2 cut(s)	443, 544
AvaII	GGWCC	2 cut(s)	456, 479
AxyI	CCTNAGG	1 cut(s)	186
BaeGI	GKGCMC	1 cut(s)	353
BbsI	GAAGAC	1 cut(s)	323
Bbv12I	GWGCWC	1 cut(s)	38
BccI	CCATC	2 cut(s)	309, 428
BciT130I	CCWGG	1 cut(s)	474
BfaI	CTAG	5 cut(s)	158, 357, 366, 555, 566
BfrI	CTTAAG	1 cut(s)	404
BmcAI	AGTACT	1 cut(s)	217
Bme1390I	CCNGG	1 cut(s)	474
Bme18I	GGWCC	2 cut(s)	456, 479
BmgT120I	GGNCC	2 cut(s)	456, 479
BmiI	GGNNCC	1 cut(s)	563
BmrFI	CCNGG	1 cut(s)	474
BmsI	GCATC	2 cut(s)	163, 484
BpiI	GAAGAC	1 cut(s)	323
BplI	GAGNNNNNCTC	2 cut(s)	250, 282
BpuEI	CTTGAG	1 cut(s)	252
BsaBI	GATNNNNATC	2 cut(s)	522, 738
BsaJI	CCNNGG	2 cut(s)	505, 634
BsaXI	ACNNNNNCTCC	2 cut(s)	415, 445
Bsc4I	CCNNNNNNNGG	1 cut(s)	465
Bse21I	CCTNAGG	1 cut(s)	186
Bse8I	GATNNNNATC	2 cut(s)	522, 738
BseBI	CCWGG	1 cut(s)	474
BseDI	CCNNGG	2 cut(s)	505, 634
BseGI	GGATG	1 cut(s)	499
BseJI	GATNNNNATC	2 cut(s)	522, 738
BseLI	CCNNNNNNNGG	1 cut(s)	465
BseMII	CTCAG	1 cut(s)	353
BseRI	GAGGAG	1 cut(s)	608
BseSI	GKGCMC	1 cut(s)	353
BsiHKAI	GWGCWC	1 cut(s)	38
BslFI	GGGAC	1 cut(s)	128
BslI	CCNNNNNNNGG	1 cut(s)	465
BsmFI	GGGAC	1 cut(s)	128
Bsp1286I	GDGCHC	2 cut(s)	38, 353
Bsp143I	GATC	1 cut(s)	657
BspCNI	CTCAG	1 cut(s)	352
BspLI	GGNNCC	1 cut(s)	563
BspQI	GCTCTTC	1 cut(s)	243
BspTI	CTTAAG	1 cut(s)	404
BssECI	CCNNGG	2 cut(s)	505, 634
BssMI	GATC	1 cut(s)	657
BssT1I	CCWWGG	2 cut(s)	505, 634
Bst2UI	CCWGG	1 cut(s)	474
Bst4CI	ACNGT	2 cut(s)	551, 691
Bst6I	CTCTTC	1 cut(s)	243
BstAFI	CTTAAG	1 cut(s)	404
BstDEI	CTNAG	4 cut(s)	141, 186, 251, 339
BstF5I	GGATG	1 cut(s)	499
BstKTI	GATC	1 cut(s)	660
BstMBI	GATC	1 cut(s)	657
BstMWI	GCNNNNNNNGC	1 cut(s)	242
BstNI	CCWGG	1 cut(s)	474
BstSCI	CCNGG	1 cut(s)	472
BstSLI	GKGCMC	1 cut(s)	353
BstV2I	GAAGAC	1 cut(s)	323
Bsu36I	CCTNAGG	1 cut(s)	186
BtsCI	GGATG	1 cut(s)	499
BtsIMutI	CAGTG	1 cut(s)	687
CaiI	CAGNNNCTG	1 cut(s)	346
Cfr13I	GGNCC	2 cut(s)	456, 479
Csp6I	GTAC	3 cut(s)	216, 369, 393
CviAII	CATG	3 cut(s)	372, 420, 647
CviJI	RGCY	8 cut(s)	5, 13, 73, 140, 161, 201, 236, 504
CviKI_1	RGCY	8 cut(s)	5, 13, 73, 140, 161, 201, 236, 504
CviQI	GTAC	3 cut(s)	216, 369, 393
DdeI	CTNAG	4 cut(s)	141, 186, 251, 339
DpnI	GATC	1 cut(s)	659
DpnII	GATC	1 cut(s)	657
Eam1104I	CTCTTC	1 cut(s)	243
EarI	CTCTTC	1 cut(s)	243
Eco130I	CCWWGG	2 cut(s)	505, 634
Eco47I	GGWCC	2 cut(s)	456, 479
Eco57I	CTGAAG	1 cut(s)	548
Eco81I	CCTNAGG	1 cut(s)	186
EcoRII	CCWGG	1 cut(s)	472
EcoT14I	CCWWGG	2 cut(s)	505, 634
ErhI	CCWWGG	2 cut(s)	505, 634
FaeI	CATG	3 cut(s)	375, 423, 650
FalI	AAGNNNNNCTT	2 cut(s)	225, 257
FaqI	GGGAC	1 cut(s)	128
FatI	CATG	3 cut(s)	371, 419, 646
FokI	GGATG	1 cut(s)	506
FspBI	CTAG	5 cut(s)	158, 357, 366, 555, 566
Hin1II	CATG	3 cut(s)	375, 423, 650
HinfI	GANTC	7 cut(s)	92, 131, 207, 229, 469, 523, 596
HphI	GGTGA	2 cut(s)	443, 544
Hpy166II	GTNNAC	2 cut(s)	479, 644
Hpy188I	TCNGA	2 cut(s)	306, 528
Hpy188III	TCNNGA	1 cut(s)	211
Hpy8I	GTNNAC	2 cut(s)	479, 644
HpyAV	CCTTC	3 cut(s)	363, 523, 529
HpyCH4III	ACNGT	2 cut(s)	551, 691
HpyCH4V	TGCA	3 cut(s)	61, 154, 245
HpyF10VI	GCNNNNNNNGC	1 cut(s)	242
HpyF3I	CTNAG	4 cut(s)	141, 186, 251, 339
Hsp92II	CATG	3 cut(s)	375, 423, 650
Kzo9I	GATC	1 cut(s)	657
LguI	GCTCTTC	1 cut(s)	243
LpnPI	CCDG	7 cut(s)	32, 97, 395, 459, 486, 612, 646
LweI	GCATC	2 cut(s)	163, 484
MaeI	CTAG	5 cut(s)	158, 357, 366, 555, 566
MalI	GATC	1 cut(s)	659
MboI	GATC	1 cut(s)	657
MboII	GAAGA	2 cut(s)	230, 328
MfeI	CAATTG	1 cut(s)	163
MhlI	GDGCHC	2 cut(s)	38, 353
MlyI	GAGTC	1 cut(s)	605
MmeI	TCCRAC	1 cut(s)	539
MnlI	CCTC	2 cut(s)	417, 586
MseI	TTAA	5 cut(s)	107, 263, 405, 489, 693
MspCI	CTTAAG	1 cut(s)	404
MspR9I	CCNGG	1 cut(s)	474
MunI	CAATTG	1 cut(s)	163
MvaI	CCWGG	1 cut(s)	474
MwoI	GCNNNNNNNGC	1 cut(s)	242
NdeII	GATC	1 cut(s)	657
NlaIII	CATG	3 cut(s)	375, 423, 650
NlaIV	GGNNCC	1 cut(s)	563
PciSI	GCTCTTC	1 cut(s)	243
PfeI	GAWTC	6 cut(s)	92, 131, 207, 229, 469, 523
PleI	GAGTC	1 cut(s)	604
PpsI	GAGTC	1 cut(s)	604
PsiI	TTATAA	2 cut(s)	23, 716
Psp6I	CCWGG	1 cut(s)	472
PspGI	CCWGG	1 cut(s)	472
PspN4I	GGNNCC	1 cut(s)	563
PspPI	GGNCC	2 cut(s)	456, 479
PstNI	CAGNNNCTG	1 cut(s)	346
RsaI	GTAC	3 cut(s)	217, 370, 394
RsaNI	GTAC	3 cut(s)	216, 369, 393
SapI	GCTCTTC	1 cut(s)	243
SaqAI	TTAA	5 cut(s)	107, 263, 405, 489, 693
Sau3AI	GATC	1 cut(s)	657
Sau96I	GGNCC	2 cut(s)	456, 479
ScaI	AGTACT	1 cut(s)	217
SchI	GAGTC	1 cut(s)	605
ScrFI	CCNGG	1 cut(s)	474
SduI	GDGCHC	2 cut(s)	38, 353
SfaNI	GCATC	2 cut(s)	163, 484
SinI	GGWCC	2 cut(s)	456, 479
SmlI	CTYRAG	2 cut(s)	267, 404
SmoI	CTYRAG	2 cut(s)	267, 404
SspMI	CTAG	5 cut(s)	158, 357, 366, 555, 566
StyD4I	CCNGG	1 cut(s)	472
StyI	CCWWGG	2 cut(s)	505, 634
TaaI	ACNGT	2 cut(s)	551, 691
TaqII	GACCGA	1 cut(s)	473
TatI	WGTACW	2 cut(s)	215, 368
TfiI	GAWTC	6 cut(s)	92, 131, 207, 229, 469, 523
Tru1I	TTAA	5 cut(s)	107, 263, 405, 489, 693
Tru9I	TTAA	5 cut(s)	107, 263, 405, 489, 693
TscAI	CASTG	1 cut(s)	694
TspDTI	ATGAA	4 cut(s)	83, 242, 315, 323
TspRI	CASTG	1 cut(s)	694
Vha464I	CTTAAG	1 cut(s)	404
VpaK11BI	GGWCC	2 cut(s)	456, 479
XapI	RAATTY	3 cut(s)	25, 448, 727
XcmI	CCANNNNNNNNNTGG	2 cut(s)	169, 623
XspI	CTAG	5 cut(s)	158, 357, 366, 555, 566
ZrmI	AGTACT	1 cut(s)	217

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.