Rmu_sc0002354.1_g000044

Ribonuclease H

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002354.1
Physical Location & Seq
Reverse (-)
216644 .. 217700
1057 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002354.1_g000044.1.cds

Sequence Viewer

Length: 939 bp
atggtttactacactcctaacattggtaatgcagctgcttctgctattagtaaaatctgtggatctcccctaactgatgaccttggggtgtaccttggtatgcctttgattcatgcaagggtcagtaagaatacttacacagggattgttgataaggtccagtctagattggctagctggaagagcaagaccttgaacatggctggtcggttaactcttatccagtctgttaactcttcaattttggtctatgctatgcaaactgcaaagctccgtactcaaacctgtgacaaattggataagattaatcgagatttcttctggggagacactgagcagaaaaggaagattcacctcacaaatagggatatggtgtgtaggcctaagtgctttggtgggctggaaataaagaagaataaggccatgcttgcaaaagccagctggagaattattcagaatgatcaaggattatggagcaaaggcctaaattggaggattggtgatggggctaaggcaaaattctggactgataagtggttcccatgtggtattcttaaagaccatgctttaaatgttggaagcattgatttaagctctactgtccagaacttttggattgataggaattggaacttatctatgttacaagctaaccttcatgctgaaatcgttgataaaattgttgctatccctatagctaactctgagttgcctgatcaagttatttggggtggtacttcatcagggattttctctgttaaatctgcctataggattctttgtgatgagcagggacttcatagctatagttggttgaggaattggtatcttcctatccctcccaagctcaaaatctttctttggtcctttgttccaagcaagctgctaactaatgagcagcgctttagacgaaaactcacttccaatccctcctgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

312

Amino Acids

35.39

Weight (kDa)

9.74

Isoelectric Point (pI)

27.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 70
AcsI RAATTY 1 cut(s) 518
AfaI GTAC 3 cut(s) 92, 277, 736
AfeI AGCGCT 1 cut(s) 902
AfiI CCNNNNNNNGG 1 cut(s) 23
AgsI TTSAA 2 cut(s) 196, 240
Alw26I GTCTC 1 cut(s) 321
AlwI GGATC 1 cut(s) 70
Aor51HI AGCGCT 1 cut(s) 902
AoxI GGCC 3 cut(s) 380, 420, 481
ApeKI GCWGC 4 cut(s) 32, 35, 883, 898
ApoI RAATTY 1 cut(s) 518
AseI ATTAAT 1 cut(s) 306
AspLEI GCGC 1 cut(s) 903
AspS9I GGNCC 2 cut(s) 157, 864
AsuHPI GGTGA 2 cut(s) 344, 512
AsuNHI GCTAGC 1 cut(s) 173
AvaII GGWCC 2 cut(s) 157, 864
BbvI GCAGC 4 cut(s) 22, 44, 870, 910
BccI CCATC 1 cut(s) 497
BclI TGATCA 2 cut(s) 460, 715
BcoDI GTCTC 1 cut(s) 321
BfaI CTAG 3 cut(s) 165, 174, 937
BfmI CTRYAG 3 cut(s) 693, 769, 805
BfoI RGCGCY 1 cut(s) 904
BisI GCNGC 4 cut(s) 33, 36, 884, 899
BlsI GCNGC 4 cut(s) 34, 37, 885, 900
Bme18I GGWCC 2 cut(s) 157, 864
BmgT120I GGNCC 2 cut(s) 157, 864
BmiI GGNNCC 1 cut(s) 539
BmtI GCTAGC 1 cut(s) 177
BpmI CTGGAG 1 cut(s) 463
Bpu10I CCTNAGC 1 cut(s) 510
BsaJI CCNNGG 2 cut(s) 82, 94
BsaXI ACNNNNNCTCC 2 cut(s) 484, 514
Bsc4I CCNNNNNNNGG 1 cut(s) 23
Bse1I ACTGG 2 cut(s) 160, 223
BseDI CCNNGG 2 cut(s) 82, 94
BseLI CCNNNNNNNGG 1 cut(s) 23
BseMII CTCAG 2 cut(s) 324, 696
BseNI ACTGG 2 cut(s) 160, 223
BseXI GCAGC 4 cut(s) 22, 44, 870, 910
BshFI GGCC 3 cut(s) 382, 422, 483
BslFI GGGAC 1 cut(s) 807
BslI CCNNNNNNNGG 1 cut(s) 23
BsmAI GTCTC 1 cut(s) 321
BsmFI GGGAC 1 cut(s) 807
BsnI GGCC 3 cut(s) 382, 422, 483
Bsp143I GATC 3 cut(s) 62, 460, 715
BspANI GGCC 3 cut(s) 382, 422, 483
BspCNI CTCAG 2 cut(s) 325, 697
BspLI GGNNCC 1 cut(s) 539
BspOI GCTAGC 1 cut(s) 177
BspPI GGATC 1 cut(s) 70
BspQI GCTCTTC 1 cut(s) 176
BsrI ACTGG 2 cut(s) 160, 223
BssECI CCNNGG 2 cut(s) 82, 94
BssMI GATC 3 cut(s) 62, 460, 715
BssT1I CCWWGG 2 cut(s) 82, 94
Bst4CI ACNGT 1 cut(s) 601
Bst6I CTCTTC 2 cut(s) 176, 241
BstC8I GCNNGC 4 cut(s) 175, 429, 439, 881
BstDEI CTNAG 4 cut(s) 333, 384, 510, 705
BstH2I RGCGCY 1 cut(s) 904
BstHHI GCGC 1 cut(s) 903
BstKTI GATC 3 cut(s) 65, 463, 718
BstMAI GTCTC 1 cut(s) 321
BstMBI GATC 3 cut(s) 62, 460, 715
BstMWI GCNNNNNNNGC 3 cut(s) 41, 183, 428
BstSFI CTRYAG 3 cut(s) 693, 769, 805
BstV1I GCAGC 4 cut(s) 22, 44, 870, 910
BstX2I RGATCY 1 cut(s) 62
BstYI RGATCY 1 cut(s) 62
BsuRI GGCC 3 cut(s) 382, 422, 483
BtsIMutI CAGTG 1 cut(s) 330
Cac8I GCNNGC 4 cut(s) 175, 429, 439, 881
CfoI GCGC 1 cut(s) 903
Cfr13I GGNCC 2 cut(s) 157, 864
Csp6I GTAC 3 cut(s) 91, 276, 735
CviAII CATG 6 cut(s) 113, 199, 424, 543, 563, 659
CviQI GTAC 3 cut(s) 91, 276, 735
DdeI CTNAG 4 cut(s) 333, 384, 510, 705
DpnI GATC 3 cut(s) 64, 462, 717
DpnII GATC 3 cut(s) 62, 460, 715
DraI TTTAAA 1 cut(s) 570
Eam1104I CTCTTC 2 cut(s) 176, 241
EarI CTCTTC 2 cut(s) 176, 241
Eco130I CCWWGG 2 cut(s) 82, 94
Eco147I AGGCCT 2 cut(s) 382, 483
Eco47I GGWCC 2 cut(s) 157, 864
Eco47III AGCGCT 1 cut(s) 902
EcoT14I CCWWGG 2 cut(s) 82, 94
ErhI CCWWGG 2 cut(s) 82, 94
FaeI CATG 6 cut(s) 116, 202, 427, 546, 566, 662
FalI AAGNNNNNCTT 2 cut(s) 639, 671
FaqI GGGAC 1 cut(s) 807
FatI CATG 6 cut(s) 112, 198, 423, 542, 562, 658
FbaI TGATCA 2 cut(s) 460, 715
Fnu4HI GCNGC 4 cut(s) 33, 36, 884, 899
Fsp4HI GCNGC 4 cut(s) 33, 36, 884, 899
FspBI CTAG 3 cut(s) 165, 174, 937
GlaI GCGC 1 cut(s) 902
GluI GCNGC 4 cut(s) 33, 36, 884, 899
GsuI CTGGAG 1 cut(s) 463
HaeII RGCGCY 1 cut(s) 904
HaeIII GGCC 3 cut(s) 382, 422, 483
HhaI GCGC 1 cut(s) 903
Hin1II CATG 6 cut(s) 116, 202, 427, 546, 566, 662
Hin6I GCGC 1 cut(s) 901
HinP1I GCGC 1 cut(s) 901
HincII GTYRAC 2 cut(s) 213, 232
HindII GTYRAC 2 cut(s) 213, 232
HinfI GANTC 3 cut(s) 109, 349, 775
HpaI GTTAAC 2 cut(s) 213, 232
HphI GGTGA 2 cut(s) 344, 512
Hpy166II GTNNAC 4 cut(s) 7, 91, 213, 232
Hpy188I TCNGA 2 cut(s) 456, 706
Hpy188III TCNNGA 4 cut(s) 165, 311, 523, 604
Hpy8I GTNNAC 4 cut(s) 7, 91, 213, 232
HpyAV CCTTC 1 cut(s) 665
HpyCH4III ACNGT 1 cut(s) 601
HpyCH4V TGCA 5 cut(s) 32, 116, 259, 266, 431
HpyF10VI GCNNNNNNNGC 3 cut(s) 41, 183, 428
HpyF3I CTNAG 4 cut(s) 333, 384, 510, 705
Hsp92II CATG 6 cut(s) 116, 202, 427, 546, 566, 662
HspAI GCGC 1 cut(s) 901
Ksp22I TGATCA 2 cut(s) 460, 715
KspAI GTTAAC 2 cut(s) 213, 232
Kzo9I GATC 3 cut(s) 62, 460, 715
LguI GCTCTTC 1 cut(s) 176
LmnI GCTCC 2 cut(s) 276, 474
Lsp1109I GCAGC 4 cut(s) 22, 44, 870, 910
MaeI CTAG 3 cut(s) 165, 174, 937
MaeIII GTNAC 2 cut(s) 287, 642
MalI GATC 3 cut(s) 64, 462, 717
MboI GATC 3 cut(s) 62, 460, 715
MboII GAAGA 6 cut(s) 193, 228, 310, 358, 424, 821
MflI RGATCY 1 cut(s) 62
MluCI AATT 8 cut(s) 240, 293, 447, 487, 518, 625, 678, 820
MmeI TCCRAC 1 cut(s) 556
MnlI CCTC 4 cut(s) 365, 486, 810, 849
MseI TTAA 7 cut(s) 212, 231, 306, 555, 569, 590, 759
MspA1I CMGCKG 2 cut(s) 35, 441
MwoI GCNNNNNNNGC 3 cut(s) 41, 183, 428
NdeII GATC 3 cut(s) 62, 460, 715
NheI GCTAGC 1 cut(s) 173
NlaIII CATG 6 cut(s) 116, 202, 427, 546, 566, 662
NlaIV GGNNCC 1 cut(s) 539
NmuCI GTSAC 1 cut(s) 287
PceI AGGCCT 2 cut(s) 382, 483
PciSI GCTCTTC 1 cut(s) 176
PfeI GAWTC 3 cut(s) 109, 349, 775
PkrI GCNGC 4 cut(s) 34, 37, 885, 900
PshBI ATTAAT 1 cut(s) 306
PspN4I GGNNCC 1 cut(s) 539
PspPI GGNCC 2 cut(s) 157, 864
PsuI RGATCY 1 cut(s) 62
PvuII CAGCTG 2 cut(s) 35, 441
RsaI GTAC 3 cut(s) 92, 277, 736
RsaNI GTAC 3 cut(s) 91, 276, 735
SapI GCTCTTC 1 cut(s) 176
SaqAI TTAA 7 cut(s) 212, 231, 306, 555, 569, 590, 759
SatI GCNGC 4 cut(s) 33, 36, 884, 899
Sau3AI GATC 3 cut(s) 62, 460, 715
Sau96I GGNCC 2 cut(s) 157, 864
SfcI CTRYAG 3 cut(s) 693, 769, 805
SinI GGWCC 2 cut(s) 157, 864
Sse9I AATT 8 cut(s) 240, 293, 447, 487, 518, 625, 678, 820
SseBI AGGCCT 2 cut(s) 382, 483
SspMI CTAG 3 cut(s) 165, 174, 937
StuI AGGCCT 2 cut(s) 382, 483
StyI CCWWGG 2 cut(s) 82, 94
TaaI ACNGT 1 cut(s) 601
TaqI TCGA 1 cut(s) 310
TasI AATT 8 cut(s) 240, 293, 447, 487, 518, 625, 678, 820
TfiI GAWTC 3 cut(s) 109, 349, 775
Tru1I TTAA 7 cut(s) 212, 231, 306, 555, 569, 590, 759
Tru9I TTAA 7 cut(s) 212, 231, 306, 555, 569, 590, 759
TscAI CASTG 1 cut(s) 337
TseFI GTSAC 1 cut(s) 287
TseI GCWGC 4 cut(s) 32, 35, 883, 898
Tsp45I GTSAC 1 cut(s) 287
TspDTI ATGAA 4 cut(s) 101, 647, 729, 788
TspGWI ACGGA 1 cut(s) 263
TspRI CASTG 1 cut(s) 337
VpaK11BI GGWCC 2 cut(s) 157, 864
VspI ATTAAT 1 cut(s) 306
XapI RAATTY 1 cut(s) 518
XbaI TCTAGA 1 cut(s) 164
XspI CTAG 3 cut(s) 165, 174, 937
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.