Rmu_sc0001512.1_g000020

Ribonuclease H

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001512.1
Physical Location & Seq
Reverse (-)
84613 .. 85245
633 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001512.1_g000020.1.cds

Sequence Viewer

Length: 633 bp
atgcctgtgtatgctatgcaaactgtgaaaattcctgcttctgtgtgtgatactttggaacaattaaacaggaattttctgtggggtgactacaatgatagcaggaaaattcatcttgccaattgggatttagtttgtagacccaagatatttggaggtctaggaataaaaaggattagacaaatgaatcaggcaatgcttgctaagattgggtggtggatgactcaaggtgatgggggtttatggagcaaggttcttcatcaaaagtacgtcaaagacactcctcttctccatgctaattattcttgtccttctaggagctctagcacttggagaagtattctccatggtgttcaattgttgaagaaagggttaatctggcgaattggtgatggggctactgttaatttttggaatgacaattggacatctgatggacctttgcttcaaaacattgctgatacgactaatgtcaatcttgacaccaaagttaatgagtgttggagcgatagggaatggaatttgaactttctcaagatgcattttggtgatgatgttattaatagaattgttaaaacacctgttgtagatacctctactagcatgactagtttgctatctcaccaagcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

210

Amino Acids

24.0

Weight (kDa)

9.08

Isoelectric Point (pI)

32.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 139
AcsI RAATTY 4 cut(s) 30, 73, 108, 520
AfaI GTAC 1 cut(s) 269
AgsI TTSAA 4 cut(s) 356, 364, 449, 526
AhlI ACTAGT 1 cut(s) 608
AluBI AGCT 1 cut(s) 321
AluI AGCT 1 cut(s) 321
Alw21I GWGCWC 1 cut(s) 323
ApoI RAATTY 4 cut(s) 30, 73, 108, 520
AseI ATTAAT 1 cut(s) 561
AspS9I GGNCC 1 cut(s) 437
AsuHPI GGTGA 5 cut(s) 98, 242, 401, 560, 614
AvaII GGWCC 1 cut(s) 437
BanII GRGCYC 1 cut(s) 323
Bbv12I GWGCWC 1 cut(s) 323
BccI CCATC 3 cut(s) 227, 386, 428
BcuI ACTAGT 1 cut(s) 608
BfaI CTAG 5 cut(s) 161, 315, 324, 600, 609
Bme18I GGWCC 1 cut(s) 437
BmgT120I GGNCC 1 cut(s) 437
BmsI GCATC 1 cut(s) 528
BoxI GACNNNNGTC 1 cut(s) 470
BpuEI CTTGAG 2 cut(s) 210, 518
BsaJI CCNNGG 1 cut(s) 346
Bse3DI GCAATG 2 cut(s) 201, 453
BseDI CCNNGG 1 cut(s) 346
BseGI GGATG 1 cut(s) 225
BseMI GCAATG 2 cut(s) 201, 453
BseRI GAGGAG 1 cut(s) 273
BsiHKAI GWGCWC 1 cut(s) 323
Bsp1286I GDGCHC 1 cut(s) 323
Bsp19I CCATGG 1 cut(s) 346
BsrDI GCAATG 2 cut(s) 201, 453
BssECI CCNNGG 1 cut(s) 346
BssT1I CCWWGG 1 cut(s) 346
Bst4CI ACNGT 2 cut(s) 25, 403
Bst6I CTCTTC 1 cut(s) 291
BstAPI GCANNNNNTGC 1 cut(s) 200
BstC8I GCNNGC 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 204
BstDSI CCRYGG 1 cut(s) 346
BstF5I GGATG 1 cut(s) 225
BstMWI GCNNNNNNNGC 1 cut(s) 200
BstPAI GACNNNNGTC 1 cut(s) 470
BtgI CCRYGG 1 cut(s) 346
BtsCI GGATG 1 cut(s) 225
Cac8I GCNNGC 1 cut(s) 201
Cfr13I GGNCC 1 cut(s) 437
Csp6I GTAC 1 cut(s) 268
CviAII CATG 3 cut(s) 293, 347, 604
CviJI RGCY 2 cut(s) 321, 398
CviKI_1 RGCY 2 cut(s) 321, 398
CviQI GTAC 1 cut(s) 268
DdeI CTNAG 1 cut(s) 204
Eam1104I CTCTTC 1 cut(s) 291
EarI CTCTTC 1 cut(s) 291
Ecl136II GAGCTC 1 cut(s) 321
Eco130I CCWWGG 1 cut(s) 346
Eco24I GRGCYC 1 cut(s) 323
Eco47I GGWCC 1 cut(s) 437
Eco53kI GAGCTC 1 cut(s) 321
EcoICRI GAGCTC 1 cut(s) 321
EcoT14I CCWWGG 1 cut(s) 346
EcoT22I ATGCAT 1 cut(s) 543
EcoT38I GRGCYC 1 cut(s) 323
ErhI CCWWGG 1 cut(s) 346
FaeI CATG 3 cut(s) 296, 350, 607
FaiI YATR 7 cut(s) 12, 17, 244, 294, 348, 605, 631
FatI CATG 3 cut(s) 292, 346, 603
FblI GTMKAC 1 cut(s) 139
FokI GGATG 1 cut(s) 232
FriOI GRGCYC 1 cut(s) 323
FspBI CTAG 5 cut(s) 161, 315, 324, 600, 609
Hin1II CATG 3 cut(s) 296, 350, 607
HinfI GANTC 2 cut(s) 187, 223
HphI GGTGA 5 cut(s) 98, 242, 401, 560, 614
Hpy166II GTNNAC 1 cut(s) 140
Hpy188I TCNGA 1 cut(s) 433
Hpy188III TCNNGA 2 cut(s) 479, 535
Hpy8I GTNNAC 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 321
HpyCH4III ACNGT 2 cut(s) 25, 403
HpyCH4IV ACGT 1 cut(s) 270
HpyCH4V TGCA 2 cut(s) 19, 541
HpyF10VI GCNNNNNNNGC 1 cut(s) 200
HpyF3I CTNAG 1 cut(s) 204
HpySE526I ACGT 1 cut(s) 270
Hsp92II CATG 3 cut(s) 296, 350, 607
LmnI GCTCC 3 cut(s) 246, 318, 504
LpnPI CCDG 7 cut(s) 18, 48, 55, 88, 176, 364, 594
LweI GCATC 1 cut(s) 528
MaeI CTAG 5 cut(s) 161, 315, 324, 600, 609
MaeII ACGT 1 cut(s) 270
MaeIII GTNAC 1 cut(s) 86
MboII GAAGA 3 cut(s) 248, 278, 376
MfeI CAATTG 3 cut(s) 121, 356, 421
MhlI GDGCHC 1 cut(s) 323
MlyI GAGTC 1 cut(s) 217
MmeI TCCRAC 1 cut(s) 482
MnlI CCTC 3 cut(s) 149, 294, 604
Mph1103I ATGCAT 1 cut(s) 543
MseI TTAA 6 cut(s) 65, 374, 405, 492, 561, 573
MslI CAYNNNNRTG 1 cut(s) 546
MunI CAATTG 3 cut(s) 121, 356, 421
MwoI GCNNNNNNNGC 1 cut(s) 200
NcoI CCATGG 1 cut(s) 346
NlaIII CATG 3 cut(s) 296, 350, 607
NmuCI GTSAC 1 cut(s) 86
NsiI ATGCAT 1 cut(s) 543
PfeI GAWTC 1 cut(s) 187
PleI GAGTC 1 cut(s) 217
PpsI GAGTC 1 cut(s) 217
PshAI GACNNNNGTC 1 cut(s) 470
PshBI ATTAAT 1 cut(s) 561
Psp124BI GAGCTC 1 cut(s) 323
PspPI GGNCC 1 cut(s) 437
RsaI GTAC 1 cut(s) 269
RsaNI GTAC 1 cut(s) 268
RseI CAYNNNNRTG 1 cut(s) 546
SacI GAGCTC 1 cut(s) 323
SaqAI TTAA 6 cut(s) 65, 374, 405, 492, 561, 573
Sau96I GGNCC 1 cut(s) 437
SchI GAGTC 1 cut(s) 217
SduI GDGCHC 1 cut(s) 323
SetI ASST 8 cut(s) 160, 232, 255, 273, 323, 442, 583, 596
SfaNI GCATC 1 cut(s) 528
SinI GGWCC 1 cut(s) 437
SmiMI CAYNNNNRTG 1 cut(s) 546
SmlI CTYRAG 2 cut(s) 225, 533
SmoI CTYRAG 2 cut(s) 225, 533
SpeI ACTAGT 1 cut(s) 608
SspMI CTAG 5 cut(s) 161, 315, 324, 600, 609
SstI GAGCTC 1 cut(s) 323
StyI CCWWGG 1 cut(s) 346
TaaI ACNGT 2 cut(s) 25, 403
TaiI ACGT 1 cut(s) 273
TfiI GAWTC 1 cut(s) 187
Tru1I TTAA 6 cut(s) 65, 374, 405, 492, 561, 573
Tru9I TTAA 6 cut(s) 65, 374, 405, 492, 561, 573
TseFI GTSAC 1 cut(s) 86
Tsp45I GTSAC 1 cut(s) 86
TspDTI ATGAA 3 cut(s) 101, 200, 248
VpaK11BI GGWCC 1 cut(s) 437
VspI ATTAAT 1 cut(s) 561
XapI RAATTY 4 cut(s) 30, 73, 108, 520
XmiI GTMKAC 1 cut(s) 139
XspI CTAG 5 cut(s) 161, 315, 324, 600, 609
Zsp2I ATGCAT 1 cut(s) 543
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.