Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001618.1

Orthogroup ID

OG0001772

Physical Location & Seq

Genomic Coordinates Forward (+)

1751 .. 4172

Gene Structure 2422 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001618.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 810 bp

atgcggggcgtgccagcacacggccagaaggccaagtgtgcaactgtaggtatagtggatgtaaatctgacttatcaagcaattgttagccgaggaaggaacttattctcggctgtgcttttaaagaaaggcttaatttggagaattggtgatggttgttctgtcaatttttggaatgatacctggttatctattggtccccttagtccatatgcctctaatgctgttactattaataatgatttgaaaatcaaggattgttggagtggtgatagctggaatttggtattcctcaaatcccagttgagtgatgatattgttaatcagatcattaaagtgtctccaggttttgtgggttgtggttctgataaagttatttggaatggtactagcaatggccactttatagtgaaatcagcttactctatcatcatccaggaggaaaatcttggaaattgccccaaattgatcattgatgctatcaaagaatggacctctgctaatgtgaccaaggccaattctgatggtagaatatcagcatggtgtggaataaacctccagtcaacttttacaaacttaatgttgatggtgcccgaaatcagaatggacaaatcggagctgtttcctcactgtgaagttagccacatatatcgtgagattaatcaggttgctgatgtgctttctaaatctggagcggatgttaagattggagtgcatgttatggagcaacctcctccacaagttacttccttcttgttggatgacttgtgtgaatatcctagatataggacagtagtttctagagtgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

269

Amino Acids

29.76

Weight (kDa)

7.56

Isoelectric Point (pI)

17.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001772)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g04886 FvH4_2g12003 FvH4_5g27492
rosa_chinensis	RchiOBHm_Chr1g0382551 RchiOBHm_Chr1g0384551
rosa_laevigata	RLG00000002160
rosa_multiflora	Rmu_co8264107.1_g000001 Rmu_co8333359.1_g000001 Rmu_sc0000295.1_g000023 Rmu_sc0000657.1_g000002 Rmu_sc0000935.1_g000036 Rmu_sc0001150.1_g000003 Rmu_sc0001484.1_g000025 Rmu_sc0001512.1_g000020 Rmu_sc0001618.1_g000002 Rmu_sc0001809.1_g000022 Rmu_sc0002354.1_g000044 Rmu_sc0002522.1_g000061 Rmu_sc0004175.1_g000004 Rmu_sc0004200.1_g000003 Rmu_sc0004569.1_g000010 Rmu_sc0005950.1_g000002 Rmu_sc0006862.1_g000009 Rmu_sc0007977.1_g000017 Rmu_sc0008049.1_g000020 Rmu_sc0008752.1_g000003 Rmu_sc0009440.1_g000002 Rmu_sc0009969.1_g000003 Rmu_sc0010108.1_g000001 Rmu_sc0010822.1_g000003 Rmu_sc0010883.1_g000006 Rmu_sc0017237.1_g000001 Rmu_sc0018807.1_g000013 Rmu_sc0027036.1_g000002 Rmu_sc0033849.1_g000001 Rmu_ssc0000387.1_g000008
rosa_roxburghii	Rroxscaffold_2G00087680 Rroxscaffold_3G00224640 Rroxscaffold_7G00179230
rosa_rugosa	Rorug01G0040100 Rorug01G0390700 Rorug02G0557500 Rorug03G0004200 Rorug04G0040100 Rorug07G0095000 Rorug07G0277300
rosa_samantha	Rh5BG202500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	589
AccBSI	CCGCTC	1 cut(s)	695
AciI	CCGC	2 cut(s)	4, 695
AcoI	YGGCCR	2 cut(s)	22, 397
AcsI	RAATTY	1 cut(s)	280
AfaI	GTAC	1 cut(s)	388
AfiI	CCNNNNNNNGG	1 cut(s)	20
AgsI	TTSAA	1 cut(s)	247
AjnI	CCWGG	3 cut(s)	182, 343, 435
AluBI	AGCT	3 cut(s)	276, 419, 619
AluI	AGCT	3 cut(s)	276, 419, 619
Alw26I	GTCTC	1 cut(s)	345
AoxI	GGCC	4 cut(s)	22, 30, 397, 513
ApoI	RAATTY	1 cut(s)	280
AseI	ATTAAT	2 cut(s)	234, 660
Asp700I	GAANNNNTTC	1 cut(s)	104
AspS9I	GGNCC	2 cut(s)	197, 492
AsuHPI	GGTGA	2 cut(s)	161, 281
AvaII	GGWCC	2 cut(s)	197, 492
BaeGI	GKGCMC	1 cut(s)	594
BalI	TGGCCA	1 cut(s)	399
BanI	GGYRCC	1 cut(s)	589
BccI	CCATC	3 cut(s)	146, 518, 580
BceAI	ACGGC	1 cut(s)	37
BciT130I	CCWGG	3 cut(s)	184, 345, 437
BclI	TGATCA	1 cut(s)	468
BcoDI	GTCTC	1 cut(s)	345
BfaI	CTAG	3 cut(s)	390, 780, 801
BfmI	CTRYAG	1 cut(s)	45
Bme1390I	CCNGG	3 cut(s)	184, 345, 437
Bme18I	GGWCC	2 cut(s)	197, 492
BmgT120I	GGNCC	2 cut(s)	197, 492
BmiI	GGNNCC	2 cut(s)	199, 591
BmrFI	CCNGG	3 cut(s)	184, 345, 437
BmrI	ACTGGG	1 cut(s)	295
BmsI	GCATC	1 cut(s)	466
BmuI	ACTGGG	1 cut(s)	295
BpmI	CTGGAG	3 cut(s)	327, 542, 711
BsaBI	GATNNNNATC	1 cut(s)	63
BsaJI	CCNNGG	2 cut(s)	91, 510
BsaXI	ACNNNNNCTCC	6 cut(s)	133, 163, 684, 702, 714, 732
Bsc4I	CCNNNNNNNGG	1 cut(s)	20
Bse1I	ACTGG	2 cut(s)	301, 559
Bse3DI	GCAATG	1 cut(s)	400
Bse8I	GATNNNNATC	1 cut(s)	63
BseBI	CCWGG	3 cut(s)	184, 345, 437
BseDI	CCNNGG	2 cut(s)	91, 510
BseGI	GGATG	4 cut(s)	64, 432, 703, 766
BseJI	GATNNNNATC	1 cut(s)	63
BseLI	CCNNNNNNNGG	1 cut(s)	20
BseMI	GCAATG	1 cut(s)	400
BseNI	ACTGG	2 cut(s)	301, 559
BseRI	GAGGAG	1 cut(s)	723
BseSI	GKGCMC	1 cut(s)	594
BshFI	GGCC	4 cut(s)	24, 32, 399, 515
BshNI	GGYRCC	1 cut(s)	589
BslFI	GGGAC	1 cut(s)	183
BslI	CCNNNNNNNGG	1 cut(s)	20
BsmAI	GTCTC	1 cut(s)	345
BsmFI	GGGAC	1 cut(s)	183
BsnI	GGCC	4 cut(s)	24, 32, 399, 515
Bsp1286I	GDGCHC	1 cut(s)	594
Bsp143I	GATC	2 cut(s)	327, 468
BspACI	CCGC	2 cut(s)	4, 695
BspANI	GGCC	4 cut(s)	24, 32, 399, 515
BspLI	GGNNCC	2 cut(s)	199, 591
BspT107I	GGYRCC	1 cut(s)	589
BsrBI	CCGCTC	1 cut(s)	695
BsrDI	GCAATG	1 cut(s)	400
BsrI	ACTGG	2 cut(s)	301, 559
BssECI	CCNNGG	2 cut(s)	91, 510
BssMI	GATC	2 cut(s)	327, 468
BssT1I	CCWWGG	1 cut(s)	510
Bst2UI	CCWGG	3 cut(s)	184, 345, 437
Bst4CI	ACNGT	3 cut(s)	46, 632, 793
BstC8I	GCNNGC	2 cut(s)	11, 15
BstDEI	CTNAG	1 cut(s)	203
BstF5I	GGATG	4 cut(s)	64, 432, 703, 766
BstKTI	GATC	2 cut(s)	330, 471
BstMAI	GTCTC	1 cut(s)	345
BstMBI	GATC	2 cut(s)	327, 468
BstMWI	GCNNNNNNNGC	3 cut(s)	10, 38, 221
BstNI	CCWGG	3 cut(s)	184, 345, 437
BstNSI	RCATGY	1 cut(s)	719
BstSCI	CCNGG	3 cut(s)	182, 343, 435
BstSFI	CTRYAG	1 cut(s)	45
BstSLI	GKGCMC	1 cut(s)	594
BsuRI	GGCC	4 cut(s)	24, 32, 399, 515
BtsCI	GGATG	4 cut(s)	64, 432, 703, 766
BtsIMutI	CAGTG	1 cut(s)	628
Cac8I	GCNNGC	2 cut(s)	11, 15
Cfr13I	GGNCC	2 cut(s)	197, 492
CsiI	ACCWGGT	1 cut(s)	182
Csp6I	GTAC	1 cut(s)	387
CviAII	CATG	2 cut(s)	540, 716
CviQI	GTAC	1 cut(s)	387
DdeI	CTNAG	1 cut(s)	203
DpnI	GATC	2 cut(s)	329, 470
DpnII	GATC	2 cut(s)	327, 468
DraI	TTTAAA	1 cut(s)	123
EaeI	YGGCCR	2 cut(s)	22, 397
Eco130I	CCWWGG	1 cut(s)	510
Eco47I	GGWCC	2 cut(s)	197, 492
EcoRII	CCWGG	3 cut(s)	182, 343, 435
EcoT14I	CCWWGG	1 cut(s)	510
ErhI	CCWWGG	1 cut(s)	510
FaeI	CATG	2 cut(s)	543, 719
FalI	AAGNNNNNCTT	2 cut(s)	116, 148
FaqI	GGGAC	1 cut(s)	183
FatI	CATG	2 cut(s)	539, 715
FauNDI	CATATG	1 cut(s)	211
FbaI	TGATCA	1 cut(s)	468
FokI	GGATG	4 cut(s)	71, 419, 710, 773
FspBI	CTAG	3 cut(s)	390, 780, 801
GsuI	CTGGAG	3 cut(s)	327, 542, 711
HaeIII	GGCC	4 cut(s)	24, 32, 399, 515
Hin1II	CATG	2 cut(s)	543, 719
HincII	GTYRAC	1 cut(s)	564
HindII	GTYRAC	1 cut(s)	564
HphI	GGTGA	2 cut(s)	161, 281
Hpy166II	GTNNAC	1 cut(s)	564
Hpy188I	TCNGA	6 cut(s)	69, 327, 367, 523, 602, 616
Hpy188III	TCNNGA	3 cut(s)	653, 690, 801
Hpy8I	GTNNAC	1 cut(s)	564
HpyAV	CCTTC	3 cut(s)	22, 90, 760
HpyCH4III	ACNGT	3 cut(s)	46, 632, 793
HpyCH4V	TGCA	2 cut(s)	41, 715
HpyF10VI	GCNNNNNNNGC	3 cut(s)	10, 38, 221
HpyF3I	CTNAG	1 cut(s)	203
Hsp92II	CATG	2 cut(s)	543, 719
Ksp22I	TGATCA	1 cut(s)	468
Kzo9I	GATC	2 cut(s)	327, 468
LmnI	GCTCC	3 cut(s)	616, 692, 724
LweI	GCATC	1 cut(s)	466
MabI	ACCWGGT	1 cut(s)	182
MaeI	CTAG	3 cut(s)	390, 780, 801
MaeIII	GTNAC	3 cut(s)	226, 505, 742
MalI	GATC	2 cut(s)	329, 470
MbiI	CCGCTC	1 cut(s)	695
MboI	GATC	2 cut(s)	327, 468
MfeI	CAATTG	1 cut(s)	81
MhlI	GDGCHC	1 cut(s)	594
MlsI	TGGCCA	1 cut(s)	399
MluCI	AATT	8 cut(s)	81, 135, 144, 166, 280, 454, 464, 517
MluNI	TGGCCA	1 cut(s)	399
MmeI	TCCRAC	2 cut(s)	242, 738
MnlI	CCTC	9 cut(s)	86, 226, 302, 433, 505, 566, 636, 741, 744
Mox20I	TGGCCA	1 cut(s)	399
MroXI	GAANNNNTTC	1 cut(s)	104
MscI	TGGCCA	1 cut(s)	399
MseI	TTAA	8 cut(s)	122, 134, 234, 321, 333, 578, 660, 702
MslI	CAYNNNNRTG	1 cut(s)	335
Msp20I	TGGCCA	1 cut(s)	399
MspR9I	CCNGG	3 cut(s)	184, 345, 437
MunI	CAATTG	1 cut(s)	81
MvaI	CCWGG	3 cut(s)	184, 345, 437
MwoI	GCNNNNNNNGC	3 cut(s)	10, 38, 221
NdeI	CATATG	1 cut(s)	211
NdeII	GATC	2 cut(s)	327, 468
NlaIII	CATG	2 cut(s)	543, 719
NlaIV	GGNNCC	2 cut(s)	199, 591
NmeAIII	GCCGAG	2 cut(s)	89, 116
NmuCI	GTSAC	1 cut(s)	505
NspI	RCATGY	1 cut(s)	719
PdmI	GAANNNNTTC	1 cut(s)	104
PfoI	TCCNGGA	1 cut(s)	435
PshBI	ATTAAT	2 cut(s)	234, 660
Psp6I	CCWGG	3 cut(s)	182, 343, 435
PspGI	CCWGG	3 cut(s)	182, 343, 435
PspN4I	GGNNCC	2 cut(s)	199, 591
PspPI	GGNCC	2 cut(s)	197, 492
RsaI	GTAC	1 cut(s)	388
RsaNI	GTAC	1 cut(s)	387
RseI	CAYNNNNRTG	1 cut(s)	335
SaqAI	TTAA	8 cut(s)	122, 134, 234, 321, 333, 578, 660, 702
Sau3AI	GATC	2 cut(s)	327, 468
Sau96I	GGNCC	2 cut(s)	197, 492
ScrFI	CCNGG	3 cut(s)	184, 345, 437
SduI	GDGCHC	1 cut(s)	594
SexAI	ACCWGGT	1 cut(s)	182
SfaNI	GCATC	1 cut(s)	466
SfcI	CTRYAG	1 cut(s)	45
SinI	GGWCC	2 cut(s)	197, 492
SmiMI	CAYNNNNRTG	1 cut(s)	335
Sse9I	AATT	8 cut(s)	81, 135, 144, 166, 280, 454, 464, 517
SsiI	CCGC	2 cut(s)	4, 695
SspMI	CTAG	3 cut(s)	390, 780, 801
StyD4I	CCNGG	3 cut(s)	182, 343, 435
StyI	CCWWGG	1 cut(s)	510
TaaI	ACNGT	3 cut(s)	46, 632, 793
TasI	AATT	8 cut(s)	81, 135, 144, 166, 280, 454, 464, 517
Tru1I	TTAA	8 cut(s)	122, 134, 234, 321, 333, 578, 660, 702
Tru9I	TTAA	8 cut(s)	122, 134, 234, 321, 333, 578, 660, 702
TscAI	CASTG	1 cut(s)	635
TseFI	GTSAC	1 cut(s)	505
Tsp45I	GTSAC	1 cut(s)	505
TspRI	CASTG	1 cut(s)	635
VpaK11BI	GGWCC	2 cut(s)	197, 492
VspI	ATTAAT	2 cut(s)	234, 660
XapI	RAATTY	1 cut(s)	280
XbaI	TCTAGA	1 cut(s)	800
XceI	RCATGY	1 cut(s)	719
XmnI	GAANNNNTTC	1 cut(s)	104
XspI	CTAG	3 cut(s)	390, 780, 801

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.