Rmu_sc0009969.1_g000003

Ribonuclease H

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009969.1
Physical Location & Seq
Forward (+)
5193 .. 5798
606 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009969.1_g000003.1.cds

Sequence Viewer

Length: 606 bp
atgctagcaaagtctagctggagaattctcaataatgattctgggttgtggcccaacatatacaaagaaaaatatcttcgcaaatgcactttgactgctactaactatcaaatccccaaggattgttctaatacctggaggagctttgttcatggtgctgctttgctgaaacgtggccttgtttggagggtgggaaatggaaaaaaaattaacttttggtctgatatttggttacctctagagcctcttattaaccatgttctaccttctgcatctttcattttggatgataagattgagagcttttgggatgatcatggctggaacctcaccaaactctctacttgtctccctcagaccatcattgatcaaattatgcatattccttccgactttgatggttgcggtgtagatgtccagatttgggggtacacttcctgtggttctttcagtgtcaaatctacttatggtatgttctttgattctcattgtcatactacttctccatcgaaattcatatggaaaatgcatttaatgcatttaattcaaggggaacttgggctattccatgttcttgaattaatactaatggcccagtcatcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

201

Amino Acids

23.08

Weight (kDa)

7.68

Isoelectric Point (pI)

49.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 405
AcsI RAATTY 2 cut(s) 24, 512
AfaI GTAC 1 cut(s) 431
AfiI CCNNNNNNNGG 1 cut(s) 424
AgsI TTSAA 2 cut(s) 548, 578
AjnI CCWGG 1 cut(s) 134
AluBI AGCT 3 cut(s) 18, 144, 303
AluI AGCT 3 cut(s) 18, 144, 303
Alw26I GTCTC 1 cut(s) 353
AoxI GGCC 3 cut(s) 50, 175, 591
ApeKI GCWGC 1 cut(s) 158
ApoI RAATTY 2 cut(s) 24, 512
AseI ATTAAT 1 cut(s) 581
AspS9I GGNCC 2 cut(s) 51, 592
AsuHPI GGTGA 1 cut(s) 322
AsuNHI GCTAGC 1 cut(s) 4
BbvI GCAGC 1 cut(s) 145
BccI CCATC 3 cut(s) 368, 392, 514
BciT130I CCWGG 1 cut(s) 136
BclI TGATCA 2 cut(s) 313, 367
BcoDI GTCTC 1 cut(s) 353
BfaI CTAG 3 cut(s) 5, 15, 239
BisI GCNGC 1 cut(s) 159
BlsI GCNGC 1 cut(s) 160
Bme1390I CCNGG 1 cut(s) 136
BmgT120I GGNCC 2 cut(s) 51, 592
BmiI GGNNCC 1 cut(s) 326
BmrFI CCNGG 1 cut(s) 136
BmrI ACTGGG 1 cut(s) 589
BmsI GCATC 1 cut(s) 281
BmtI GCTAGC 1 cut(s) 8
BmuI ACTGGG 1 cut(s) 589
BpmI CTGGAG 2 cut(s) 40, 157
BsaJI CCNNGG 1 cut(s) 117
BsaXI ACNNNNNCTCC 2 cut(s) 487, 517
Bsc4I CCNNNNNNNGG 1 cut(s) 424
Bse1I ACTGG 1 cut(s) 595
BseBI CCWGG 1 cut(s) 136
BseDI CCNNGG 1 cut(s) 117
BseGI GGATG 2 cut(s) 292, 316
BseLI CCNNNNNNNGG 1 cut(s) 424
BseMII CTCAG 1 cut(s) 368
BseNI ACTGG 1 cut(s) 595
BseRI GAGGAG 1 cut(s) 154
BseXI GCAGC 1 cut(s) 145
BshFI GGCC 3 cut(s) 52, 177, 593
BslI CCNNNNNNNGG 1 cut(s) 424
BsmAI GTCTC 1 cut(s) 353
BsnI GGCC 3 cut(s) 52, 177, 593
Bsp143I GATC 2 cut(s) 313, 367
BspACI CCGC 1 cut(s) 405
BspANI GGCC 3 cut(s) 52, 177, 593
BspCNI CTCAG 1 cut(s) 367
BspLI GGNNCC 1 cut(s) 326
BspOI GCTAGC 1 cut(s) 8
BsrI ACTGG 1 cut(s) 595
BssECI CCNNGG 1 cut(s) 117
BssMI GATC 2 cut(s) 313, 367
BssT1I CCWWGG 1 cut(s) 117
Bst2UI CCWGG 1 cut(s) 136
BstAPI GCANNNNNTGC 1 cut(s) 535
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 354
BstEII GGTNACC 1 cut(s) 231
BstF5I GGATG 2 cut(s) 292, 316
BstKTI GATC 2 cut(s) 316, 370
BstMAI GTCTC 1 cut(s) 353
BstMBI GATC 2 cut(s) 313, 367
BstMWI GCNNNNNNNGC 1 cut(s) 535
BstNI CCWGG 1 cut(s) 136
BstPI GGTNACC 1 cut(s) 231
BstSCI CCNGG 1 cut(s) 134
BstV1I GCAGC 1 cut(s) 145
BsuRI GGCC 3 cut(s) 52, 177, 593
BtsCI GGATG 2 cut(s) 292, 316
BtsIMutI CAGTG 1 cut(s) 457
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 2 cut(s) 51, 592
Csp6I GTAC 1 cut(s) 430
CviAII CATG 4 cut(s) 152, 257, 317, 569
CviJI RGCY 9 cut(s) 18, 52, 144, 177, 244, 303, 321, 562, 593
CviKI_1 RGCY 9 cut(s) 18, 52, 144, 177, 244, 303, 321, 562, 593
CviQI GTAC 1 cut(s) 430
DdeI CTNAG 1 cut(s) 354
DpnI GATC 2 cut(s) 315, 369
DpnII GATC 2 cut(s) 313, 367
Eco130I CCWWGG 1 cut(s) 117
Eco91I GGTNACC 1 cut(s) 231
EcoO65I GGTNACC 1 cut(s) 231
EcoRI GAATTC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 134
EcoT14I CCWWGG 1 cut(s) 117
EcoT22I ATGCAT 3 cut(s) 381, 531, 540
ErhI CCWWGG 1 cut(s) 117
FaeI CATG 4 cut(s) 155, 260, 320, 572
FalI AAGNNNNNCTT 2 cut(s) 540, 572
FatI CATG 4 cut(s) 151, 256, 316, 568
FauNDI CATATG 1 cut(s) 518
FbaI TGATCA 2 cut(s) 313, 367
Fnu4HI GCNGC 1 cut(s) 159
FokI GGATG 2 cut(s) 299, 323
Fsp4HI GCNGC 1 cut(s) 159
FspBI CTAG 3 cut(s) 5, 15, 239
GluI GCNGC 1 cut(s) 159
GsuI CTGGAG 2 cut(s) 40, 157
HaeIII GGCC 3 cut(s) 52, 177, 593
Hin1II CATG 4 cut(s) 155, 260, 320, 572
HinfI GANTC 2 cut(s) 38, 482
HphI GGTGA 1 cut(s) 322
Hpy166II GTNNAC 1 cut(s) 432
Hpy188I TCNGA 3 cut(s) 223, 357, 391
Hpy188III TCNNGA 3 cut(s) 239, 418, 575
Hpy8I GTNNAC 1 cut(s) 432
HpyAV CCTTC 2 cut(s) 276, 396
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 5 cut(s) 87, 272, 379, 529, 538
HpyF10VI GCNNNNNNNGC 1 cut(s) 535
HpyF3I CTNAG 1 cut(s) 354
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 4 cut(s) 155, 260, 320, 572
Ksp22I TGATCA 2 cut(s) 313, 367
Kzo9I GATC 2 cut(s) 313, 367
LmnI GCTCC 1 cut(s) 141
LpnPI CCDG 7 cut(s) 4, 27, 121, 148, 307, 431, 451
Lsp1109I GCAGC 1 cut(s) 145
LweI GCATC 1 cut(s) 281
MaeI CTAG 3 cut(s) 5, 15, 239
MaeII ACGT 1 cut(s) 172
MaeIII GTNAC 1 cut(s) 231
MalI GATC 2 cut(s) 315, 369
MboI GATC 2 cut(s) 313, 367
MboII GAAGA 1 cut(s) 68
MluCI AATT 6 cut(s) 24, 207, 372, 512, 543, 578
MmeI TCCRAC 1 cut(s) 414
MnlI CCTC 6 cut(s) 132, 180, 246, 255, 338, 363
Mph1103I ATGCAT 3 cut(s) 381, 531, 540
MseI TTAA 5 cut(s) 210, 252, 533, 542, 581
MspR9I CCNGG 1 cut(s) 136
MvaI CCWGG 1 cut(s) 136
MwoI GCNNNNNNNGC 1 cut(s) 535
NdeI CATATG 1 cut(s) 518
NdeII GATC 2 cut(s) 313, 367
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 4 cut(s) 155, 260, 320, 572
NlaIV GGNNCC 1 cut(s) 326
NsiI ATGCAT 3 cut(s) 381, 531, 540
PfeI GAWTC 2 cut(s) 38, 482
PkrI GCNGC 1 cut(s) 160
PshBI ATTAAT 1 cut(s) 581
Psp6I CCWGG 1 cut(s) 134
PspEI GGTNACC 1 cut(s) 231
PspGI CCWGG 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 326
PspPI GGNCC 2 cut(s) 51, 592
RsaI GTAC 1 cut(s) 431
RsaNI GTAC 1 cut(s) 430
SaqAI TTAA 5 cut(s) 210, 252, 533, 542, 581
SatI GCNGC 1 cut(s) 159
Sau3AI GATC 2 cut(s) 313, 367
Sau96I GGNCC 2 cut(s) 51, 592
ScrFI CCNGG 1 cut(s) 136
SetI ASST 8 cut(s) 20, 137, 146, 175, 238, 268, 305, 330
SfaNI GCATC 1 cut(s) 281
Sse9I AATT 6 cut(s) 24, 207, 372, 512, 543, 578
SsiI CCGC 1 cut(s) 405
SspMI CTAG 3 cut(s) 5, 15, 239
StyD4I CCNGG 1 cut(s) 134
StyI CCWWGG 1 cut(s) 117
TaiI ACGT 1 cut(s) 175
TaqI TCGA 1 cut(s) 509
TasI AATT 6 cut(s) 24, 207, 372, 512, 543, 578
TfiI GAWTC 2 cut(s) 38, 482
Tru1I TTAA 5 cut(s) 210, 252, 533, 542, 581
Tru9I TTAA 5 cut(s) 210, 252, 533, 542, 581
TscAI CASTG 1 cut(s) 457
TseI GCWGC 1 cut(s) 158
TspDTI ATGAA 3 cut(s) 140, 268, 505
TspRI CASTG 1 cut(s) 457
VspI ATTAAT 1 cut(s) 581
XapI RAATTY 2 cut(s) 24, 512
XbaI TCTAGA 1 cut(s) 238
XspI CTAG 3 cut(s) 5, 15, 239
Zsp2I ATGCAT 3 cut(s) 381, 531, 540
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.