Rmu_sc0002691.1_g000038

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002691.1
Physical Location & Seq
Reverse (-)
120807 .. 121745
939 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002691.1_g000038.1.cds

Sequence Viewer

Length: 939 bp
atgaagatcctaaaaagaaattcttcaagaaaaagaagaattaccgagtcaatcatcagaatactcaaccaagcaagaaagcttgcagatgctagttatgtaaagctgaagggcactatgccaatgaatgcccggaaaaagggtaaaagatctactaaagctctatttgacgaatacgagcctatagtagaaacaacaaatatgaagggctacgaaatagcctattctgatgatgaagaagacgacaggtcaatttactctgcctggtctaaagaagaatcatctgattctgaaatagattctgaagtagagtacttagaatctagacagatgaatgttctacacgtcaaaaactggaaagaaagtaaggcagaagcaataacgtcttcctaccaggtgaaccctggtgcattcgtttgtgactactgcttatgtcatgaaaagaatggacttcctatgttttgtgaaaagtcaaaaaagacttatcacaaagaatgcttcatagctgaagcaagaagaaagaccaaaaacggccttgtcagccaactggttgaacaagaatatgaagaatatttctctgagaaaaaagagaaagaattagaaattcagttccaagaaattatggaaccctcttccttaaaaataaaggaagaaaaaatcaaggaagaaaaaatcaaggaagaaaagctcgatccaactattgaattggttgaaataccagaaagtgttccaaaagaatgtaaaccattcatacctcaggaacaagctcaaaaaaatgagcttcaacaatcaaaagtcatctctactagtagatacaacaactacatagagattggactcaaattccctgatcacaaaaaatatcatctacatgcctttgtggataatggatcaggatttatagttgcaaaaagatttgcaattccagaagaactctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

312

Amino Acids

36.48

Weight (kDa)

6.39

Isoelectric Point (pI)

57.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 686, 898
AcsI RAATTY 3 cut(s) 19, 603, 842
AcuI CTGAAG 3 cut(s) 128, 324, 528
AfaI GTAC 1 cut(s) 314
AfiI CCNNNNNNNGG 1 cut(s) 139
AflIII ACRYGT 1 cut(s) 343
AgsI TTSAA 5 cut(s) 27, 554, 704, 713, 785
AhdI GACNNNNNGTC 1 cut(s) 247
AhlI ACTAGT 1 cut(s) 806
AjiI CACGTC 1 cut(s) 346
AjnI CCWGG 3 cut(s) 263, 393, 403
AluBI AGCT 7 cut(s) 82, 106, 161, 506, 688, 767, 781
AluI AGCT 7 cut(s) 82, 106, 161, 506, 688, 767, 781
AlwI GGATC 2 cut(s) 686, 898
AoxI GGCC 1 cut(s) 532
ApoI RAATTY 3 cut(s) 19, 603, 842
Asp700I GAANNNNTTC 2 cut(s) 22, 726
AsuC2I CCSGG 1 cut(s) 133
AsuHPI GGTGA 1 cut(s) 409
AxyI CCTNAGG 1 cut(s) 756
BaeGI GKGCMC 1 cut(s) 116
BbsI GAAGAC 2 cut(s) 246, 378
BceAI ACGGC 1 cut(s) 547
BciT130I CCWGG 3 cut(s) 265, 395, 405
BclI TGATCA 1 cut(s) 850
BcnI CCSGG 1 cut(s) 133
BcuI ACTAGT 1 cut(s) 806
BfaI CTAG 4 cut(s) 93, 324, 807, 937
BfmI CTRYAG 1 cut(s) 183
BglII AGATCT 1 cut(s) 149
BmcAI AGTACT 1 cut(s) 314
Bme1390I CCNGG 4 cut(s) 133, 265, 395, 405
BmeRI GACNNNNNGTC 1 cut(s) 247
BmgBI CACGTC 1 cut(s) 346
BmiI GGNNCC 1 cut(s) 627
BmrFI CCNGG 4 cut(s) 133, 265, 395, 405
BmsI GCATC 1 cut(s) 79
BpiI GAAGAC 2 cut(s) 246, 378
BpuMI CCSGG 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 403
Bsc4I CCNNNNNNNGG 1 cut(s) 139
Bse1I ACTGG 2 cut(s) 359, 552
Bse21I CCTNAGG 1 cut(s) 756
BseBI CCWGG 3 cut(s) 265, 395, 405
BseDI CCNNGG 1 cut(s) 403
BseLI CCNNNNNNNGG 1 cut(s) 139
BseMII CTCAG 2 cut(s) 570, 770
BseNI ACTGG 2 cut(s) 359, 552
BseSI GKGCMC 1 cut(s) 116
BshFI GGCC 1 cut(s) 534
BsiSI CCGG 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 139
BsmI GAATGC 3 cut(s) 133, 410, 500
BsnI GGCC 1 cut(s) 534
Bsp1286I GDGCHC 1 cut(s) 116
Bsp143I GATC 5 cut(s) 6, 149, 691, 850, 890
BspANI GGCC 1 cut(s) 534
BspCNI CTCAG 2 cut(s) 571, 769
BspHI TCATGA 1 cut(s) 436
BspLI GGNNCC 1 cut(s) 627
BspPI GGATC 2 cut(s) 686, 898
BsrI ACTGG 2 cut(s) 359, 552
BssECI CCNNGG 1 cut(s) 403
BssMI GATC 5 cut(s) 6, 149, 691, 850, 890
Bst2UI CCWGG 3 cut(s) 265, 395, 405
Bst6I CTCTTC 1 cut(s) 637
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 3 cut(s) 316, 579, 756
BstKTI GATC 5 cut(s) 9, 152, 694, 853, 893
BstMBI GATC 5 cut(s) 6, 149, 691, 850, 890
BstMWI GCNNNNNNNGC 1 cut(s) 540
BstNI CCWGG 3 cut(s) 265, 395, 405
BstNSI RCATGY 1 cut(s) 875
BstSCI CCNGG 4 cut(s) 131, 263, 393, 403
BstSFI CTRYAG 1 cut(s) 183
BstSLI GKGCMC 1 cut(s) 116
BstV2I GAAGAC 2 cut(s) 246, 378
BstX2I RGATCY 2 cut(s) 6, 149
BstYI RGATCY 2 cut(s) 6, 149
Bsu36I CCTNAGG 1 cut(s) 756
BsuRI GGCC 1 cut(s) 534
BtrI CACGTC 1 cut(s) 346
Cac8I GCNNGC 1 cut(s) 84
CciI TCATGA 1 cut(s) 436
CsiI ACCWGGT 1 cut(s) 393
Csp6I GTAC 1 cut(s) 313
CviAII CATG 2 cut(s) 437, 872
CviQI GTAC 1 cut(s) 313
DdeI CTNAG 3 cut(s) 316, 579, 756
DpnI GATC 5 cut(s) 8, 151, 693, 852, 892
DpnII GATC 5 cut(s) 6, 149, 691, 850, 890
DriI GACNNNNNGTC 1 cut(s) 247
Eam1104I CTCTTC 1 cut(s) 637
Eam1105I GACNNNNNGTC 1 cut(s) 247
EarI CTCTTC 1 cut(s) 637
Eco57I CTGAAG 3 cut(s) 128, 324, 528
Eco81I CCTNAGG 1 cut(s) 756
EcoRII CCWGG 3 cut(s) 263, 393, 403
FaeI CATG 2 cut(s) 440, 875
FalI AAGNNNNNCTT 2 cut(s) 7, 39
FatI CATG 2 cut(s) 436, 871
FbaI TGATCA 1 cut(s) 850
FspBI CTAG 4 cut(s) 93, 324, 807, 937
HaeIII GGCC 1 cut(s) 534
HapII CCGG 1 cut(s) 133
Hin1II CATG 2 cut(s) 440, 875
HindIII AAGCTT 1 cut(s) 80
HinfI GANTC 6 cut(s) 47, 278, 287, 299, 320, 837
HpaII CCGG 1 cut(s) 133
HphI GGTGA 1 cut(s) 409
Hpy166II GTNNAC 2 cut(s) 400, 743
Hpy188I TCNGA 6 cut(s) 59, 229, 286, 292, 304, 580
Hpy188III TCNNGA 6 cut(s) 27, 324, 437, 758, 894, 926
Hpy8I GTNNAC 2 cut(s) 400, 743
HpyAV CCTTC 2 cut(s) 103, 199
HpyCH4IV ACGT 2 cut(s) 345, 383
HpyCH4V TGCA 4 cut(s) 86, 410, 908, 920
HpyF10VI GCNNNNNNNGC 1 cut(s) 540
HpyF3I CTNAG 3 cut(s) 316, 579, 756
HpySE526I ACGT 2 cut(s) 345, 383
Hsp92II CATG 2 cut(s) 440, 875
Ksp22I TGATCA 1 cut(s) 850
Kzo9I GATC 5 cut(s) 6, 149, 691, 850, 890
LweI GCATC 1 cut(s) 79
MabI ACCWGGT 1 cut(s) 393
MaeI CTAG 4 cut(s) 93, 324, 807, 937
MaeII ACGT 2 cut(s) 345, 383
MaeIII GTNAC 1 cut(s) 419
MalI GATC 5 cut(s) 8, 151, 693, 852, 892
MboI GATC 5 cut(s) 6, 149, 691, 850, 890
MflI RGATCY 2 cut(s) 6, 149
MhlI GDGCHC 1 cut(s) 116
MluCI AATT 9 cut(s) 19, 39, 252, 596, 603, 618, 704, 842, 921
MlyI GAGTC 2 cut(s) 56, 831
MmeI TCCRAC 1 cut(s) 719
MnlI CCTC 2 cut(s) 640, 765
MroXI GAANNNNTTC 2 cut(s) 22, 726
MseI TTAA 1 cut(s) 638
MslI CAYNNNNRTG 1 cut(s) 870
MspI CCGG 1 cut(s) 133
MspR9I CCNGG 4 cut(s) 133, 265, 395, 405
Mva1269I GAATGC 3 cut(s) 133, 410, 500
MvaI CCWGG 3 cut(s) 265, 395, 405
MwoI GCNNNNNNNGC 1 cut(s) 540
NciI CCSGG 1 cut(s) 133
NdeII GATC 5 cut(s) 6, 149, 691, 850, 890
NlaIII CATG 2 cut(s) 440, 875
NlaIV GGNNCC 1 cut(s) 627
NmuCI GTSAC 1 cut(s) 419
NspI RCATGY 1 cut(s) 875
PagI TCATGA 1 cut(s) 436
PctI GAATGC 3 cut(s) 133, 410, 500
PdmI GAANNNNTTC 2 cut(s) 22, 726
PfeI GAWTC 4 cut(s) 278, 287, 299, 320
PleI GAGTC 2 cut(s) 55, 831
PpsI GAGTC 2 cut(s) 55, 831
Psp6I CCWGG 3 cut(s) 263, 393, 403
PspGI CCWGG 3 cut(s) 263, 393, 403
PspN4I GGNNCC 1 cut(s) 627
PsuI RGATCY 2 cut(s) 6, 149
RsaI GTAC 1 cut(s) 314
RsaNI GTAC 1 cut(s) 313
RseI CAYNNNNRTG 1 cut(s) 870
SaqAI TTAA 1 cut(s) 638
Sau3AI GATC 5 cut(s) 6, 149, 691, 850, 890
ScaI AGTACT 1 cut(s) 314
SchI GAGTC 2 cut(s) 56, 831
ScrFI CCNGG 4 cut(s) 133, 265, 395, 405
SduI GDGCHC 1 cut(s) 116
SexAI ACCWGGT 1 cut(s) 393
SfaNI GCATC 1 cut(s) 79
SfcI CTRYAG 1 cut(s) 183
SmiMI CAYNNNNRTG 1 cut(s) 870
SpeI ACTAGT 1 cut(s) 806
Sse9I AATT 9 cut(s) 19, 39, 252, 596, 603, 618, 704, 842, 921
SspI AATATT 1 cut(s) 572
SspMI CTAG 4 cut(s) 93, 324, 807, 937
StyD4I CCNGG 4 cut(s) 131, 263, 393, 403
TaiI ACGT 2 cut(s) 348, 386
TaqI TCGA 1 cut(s) 690
TasI AATT 9 cut(s) 19, 39, 252, 596, 603, 618, 704, 842, 921
TatI WGTACW 1 cut(s) 312
TfiI GAWTC 4 cut(s) 278, 287, 299, 320
Tru1I TTAA 1 cut(s) 638
Tru9I TTAA 1 cut(s) 638
TseFI GTSAC 1 cut(s) 419
Tsp45I GTSAC 1 cut(s) 419
TspDTI ATGAA 9 cut(s) 17, 140, 218, 249, 347, 453, 490, 579, 739
XapI RAATTY 3 cut(s) 19, 603, 842
XbaI TCTAGA 1 cut(s) 323
XceI RCATGY 1 cut(s) 875
XcmI CCANNNNNNNNNTGG 1 cut(s) 401
XmnI GAANNNNTTC 2 cut(s) 22, 726
XspI CTAG 4 cut(s) 93, 324, 807, 937
ZrmI AGTACT 1 cut(s) 314
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.