Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr1

Orthogroup ID

OG0001755

Physical Location & Seq

Genomic Coordinates Reverse (-)

38069176 .. 38071182

Gene Structure 2007 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw1G017190.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1764 bp

ATGTTTTGTGAAGAGTCAAAAAAGACTTATCACAAAGAATGCTTCATAGCTGAAGCAAGAAGAAAAACCAAGAATGGCCTTGTCAGCCAATTGGTTGAACAGGAATATGAAGAATACTTCTCTGAGCAGAAAGCGAAAGAAGTAGAAACAGTAGAAACTCAGTTCCAAGAAATCATGGAACCATCTTCCTCAAAAATAAAGGAAGAAATCATCGGTGAAGAAAAAATCGATGAAGATATAGAACTGGTTGAACCACTAGAAATTGTTCCAGAAGAATGTAAACCATTCATTCCAAAGGAACAGGCTCAAGAACACGAGCTTCAACAATCGAAGGTCGTCTCTACTAGTAGATACAGCAACTACATAGAGATTGGACTAAAATTCCCTGATCACAAAAAATATCATCTACATGCCTTTGTAGATAATGGATCAGGATTCACTGTTGCAAAGAGATTTGCAATTCCAGAAGAACTCAGGAAAGAAGAAAGAAAAAAAATCGCTACTGGTGTTACATTTGACGAAAGCCATCTCACCATGAATAAAGTAGCAAAAAATGTTCATATCACCATTGGTGGAGGAACATTTATCATCCATAATGTCTGGCAATCTGAAGGCCAAGGCTCAGATTTCTTGTTGGGAAATGATTTCATTCTCCAACAGAGATTTATTCAGGATGAAGAAGCGATAGGTTTCAGAAAAGGAGAACGGGTGTTCTGGGCTGACCGACTTACACAAGCAAAAAGTGTAGTAGGTCCTGGTTTTACTATGCAGTATCAGAGATCGCAACAGAATAGTGGTGATCTTACCCCCTACAAACCCAAATTTGAGCCTATACTCCAAATCAAACAACAAGAAGAATTACTTGTTGAAGAATCTTCTGAAGAAGAAAAAGAAGAAACTAGTGAAGATGAAGAAGCTAGTTTCATCCATGAGCATAACCTCAAGCACTTTCAGAATAAGCTTGAATTACATGATATGAATGCCATCTGTCATGTCAAACCTATTCCTCAGTATAAAGAGGAAGATCAAAAGGAATTCAGAAAAGATATTGAAGATCTCCTAAACAAGAGATTAATTCAACCGTCCACTAGCCCTCATCATGCTCCAGCATTCTACATGAGAAATCATGCAGAAAATCTACGAGGAAAAGCTAGAATGGTCAAGATGCATCCTGAGAGTGTTCCTCTCACTGCATTTGGAACACCACAAGGACATTACGAATGGTTGGTAATGCCTTTTGGTCTAAAGCAAGCTCCCTCAATATTCCAAAGAAAGATGGACAACATATTCAAGCATGTGGCGGAGTTCTGCGTCGTCTACATAGATGACATCCTGGGCTTCTCCAAAAACAGAGAAGAACACATGAAACACCTCCATGAGGTAGTAAAGCTAATAGTTCAGCATGGAATTATCCTAGGAGAGAAGAAAATCTTCTTTATCCTCGATGAAGTTGATTTGCTAGGCATAAACATCAAGAATGGAGTGATAAAACTCCAACCACATATCCTTGAAAAAATATGGAAGTTCCCAGATAGAATTCCTGATGCTAAGAGTCTAGAGAGATTCCTTGGTGTCATAAATTACGGGAGAGATTTCATTCCCAAAATCTCAGGGTTAACAGCAATGTTATCTCCAAAGACAAGTTCCAAAAGAAAATGGAACTTCACAAAAGATTATGAAAAGATTGTGAAGCAGATAAAAAATCTCTGCAAAAACCTCCCTCCTCTTCAACAACCAGAAGAGAATGATGAAATTATCCTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_A3 RVT_1

Protein Analysis

587

Amino Acids

68.37

Weight (kDa)

5.94

Isoelectric Point (pI)

58.61

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Peptidase_A3	PF02160	119 - 303	2.8e-17	Cauliflower mosaic virus peptidase (A3)
RVT_1	PF00078	387 - 491	2.4e-23	Reverse transcriptase (RNA-dependent DNA polymerase)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001755)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g21631 FvH4_2g10222 FvH4_4g24921 FvH4_6g05922 FvH4_6g25072
rosa_chinensis	RchiOBHm_Chr2g0093451
rosa_laevigata	RLG00000022539 RLG00000034490 RLG00000034528
rosa_multiflora	Rmu_sc0000399.1_g000026 Rmu_sc0000770.1_g000030 Rmu_sc0001851.1_g000051 Rmu_sc0002187.1_g000007 Rmu_sc0002285.1_g000023 Rmu_sc0002691.1_g000038 Rmu_sc0002818.1_g000001 Rmu_sc0002845.1_g000027 Rmu_sc0003187.1_g000014 Rmu_sc0003249.1_g000027 Rmu_sc0003467.1_g000008 Rmu_sc0004510.1_g000016 Rmu_sc0004908.1_g000009 Rmu_sc0005069.1_g000025 Rmu_sc0006196.1_g000002 Rmu_sc0006361.1_g000017 Rmu_sc0006416.1_g000013 Rmu_sc0006682.1_g000001 Rmu_sc0010379.1_g000007 Rmu_sc0010686.1_g000001 Rmu_sc0013208.1_g000001 Rmu_sc0022212.1_g000001 Rmu_sc0025570.1_g000001 Rmu_sc0027653.1_g000001 Rmu_sc0029502.1_g000001 Rmu_sc0035757.1_g000001 Rmu_ssc0000052.1_g000013 Rmu_ssc0000053.1_g000013 Rmu_ssc0000388.1_g000053 Rmu_ssc0000397.1_g000010
rosa_rugosa	Rorug05G0492200 Rorug07G0333400
rosa_samantha	Rh5BG353500 Rh6DG255600 Rh7BG334600
rosa_wichuraiana	Rw0G020000 Rw1G017190 Rw3G026880 Rw4G005210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	1317
AciI	CCGC	1 cut(s)	1301
AclWI	GGATC	1 cut(s)	436
AcsI	RAATTY	4 cut(s)	380, 821, 1034, 1536
AcuI	CTGAAG	3 cut(s)	72, 630, 900
AfiI	CCNNNNNNNGG	1 cut(s)	1378
AhlI	ACTAGT	2 cut(s)	344, 899
AjnI	CCWGG	2 cut(s)	754, 1332
AjuI	GAANNNNNNNTTGG	2 cut(s)	1627, 1659
AluBI	AGCT	7 cut(s)	50, 319, 917, 961, 1151, 1253, 1390
AluI	AGCT	7 cut(s)	50, 319, 917, 961, 1151, 1253, 1390
Alw26I	GTCTC	1 cut(s)	343
AlwI	GGATC	1 cut(s)	436
AoxI	GGCC	2 cut(s)	76, 613
ApoI	RAATTY	4 cut(s)	380, 821, 1034, 1536
AseI	ATTAAT	1 cut(s)	1073
Asp700I	GAANNNNTTC	2 cut(s)	264, 1430
AspA2I	CCTAGG	1 cut(s)	1414
AspS9I	GGNCC	1 cut(s)	752
AsuHPI	GGTGA	4 cut(s)	227, 523, 556, 809
AvaII	GGWCC	1 cut(s)	752
AvrII	CCTAGG	1 cut(s)	1414
BauI	CACGAG	1 cut(s)	314
BccI	CCATC	4 cut(s)	190, 534, 992, 1270
BciT130I	CCWGG	2 cut(s)	756, 1334
BclI	TGATCA	1 cut(s)	388
BcoDI	GTCTC	1 cut(s)	343
BcuI	ACTAGT	2 cut(s)	344, 899
BfaI	CTAG	9 cut(s)	257, 345, 900, 918, 1089, 1152, 1415, 1460, 1556
BglII	AGATCT	1 cut(s)	1054
BlnI	CCTAGG	1 cut(s)	1414
Bme1390I	CCNGG	2 cut(s)	756, 1334
Bme18I	GGWCC	1 cut(s)	752
BmgT120I	GGNCC	1 cut(s)	752
BmiI	GGNNCC	1 cut(s)	180
BmrFI	CCNGG	2 cut(s)	756, 1334
BmsI	GCATC	3 cut(s)	1155, 1177, 1534
BplI	GAGNNNNNCTC	2 cut(s)	1168, 1200
BpmI	CTGGAG	1 cut(s)	1089
BpuEI	CTTGAG	2 cut(s)	291, 926
Bsa29I	ATCGAT	1 cut(s)	228
BsaJI	CCNNGG	4 cut(s)	616, 1333, 1414, 1567
BsaXI	ACNNNNNCTCC	2 cut(s)	693, 723
Bsc4I	CCNNNNNNNGG	1 cut(s)	1378
Bse1I	ACTGG	2 cut(s)	249, 508
Bse3DI	GCAATG	1 cut(s)	1629
BseBI	CCWGG	2 cut(s)	756, 1334
BseCI	ATCGAT	1 cut(s)	228
BseDI	CCNNGG	4 cut(s)	616, 1333, 1414, 1567
BseGI	GGATG	5 cut(s)	588, 679, 924, 1168, 1329
BseLI	CCNNNNNNNGG	1 cut(s)	1378
BseMI	GCAATG	1 cut(s)	1629
BseMII	CTCAG	7 cut(s)	114, 173, 487, 636, 1022, 1164, 1623
BseNI	ACTGG	2 cut(s)	249, 508
BseRI	GAGGAG	1 cut(s)	1713
BshFI	GGCC	2 cut(s)	78, 615
BshVI	ATCGAT	1 cut(s)	228
BslI	CCNNNNNNNGG	1 cut(s)	1378
BsmAI	GTCTC	1 cut(s)	343
BsmBI	CGTCTC	1 cut(s)	343
BsmI	GAATGC	3 cut(s)	44, 985, 1109
BsnI	GGCC	2 cut(s)	78, 615
Bsp143I	GATC	6 cut(s)	388, 428, 779, 799, 1024, 1054
BspACI	CCGC	1 cut(s)	1301
BspANI	GGCC	2 cut(s)	78, 615
BspCNI	CTCAG	7 cut(s)	115, 172, 486, 635, 1021, 1165, 1622
BspDI	ATCGAT	1 cut(s)	228
BspLI	GGNNCC	1 cut(s)	180
BspPI	GGATC	1 cut(s)	436
BsrDI	GCAATG	1 cut(s)	1629
BsrI	ACTGG	2 cut(s)	249, 508
BssECI	CCNNGG	4 cut(s)	616, 1333, 1414, 1567
BssMI	GATC	6 cut(s)	388, 428, 779, 799, 1024, 1054
BssSI	CACGAG	1 cut(s)	314
BssT1I	CCWWGG	3 cut(s)	616, 1414, 1567
Bst2BI	CACGAG	1 cut(s)	314
Bst2UI	CCWGG	2 cut(s)	756, 1334
Bst4CI	ACNGT	3 cut(s)	151, 442, 1083
Bst6I	CTCTTC	3 cut(s)	6, 1731, 1734
BstC8I	GCNNGC	1 cut(s)	1251
BstDEI	CTNAG	8 cut(s)	123, 159, 473, 622, 1008, 1173, 1548, 1609
BstENI	CCTNNNNNAGG	1 cut(s)	1376
BstF5I	GGATG	5 cut(s)	588, 679, 924, 1168, 1329
BstKTI	GATC	6 cut(s)	391, 431, 782, 802, 1027, 1057
BstMAI	GTCTC	1 cut(s)	343
BstMBI	GATC	6 cut(s)	388, 428, 779, 799, 1024, 1054
BstMWI	GCNNNNNNNGC	1 cut(s)	84
BstNI	CCWGG	2 cut(s)	756, 1334
BstNSI	RCATGY	2 cut(s)	413, 1298
BstSCI	CCNGG	2 cut(s)	754, 1332
BstX2I	RGATCY	1 cut(s)	1054
BstYI	RGATCY	1 cut(s)	1054
Bsu15I	ATCGAT	1 cut(s)	228
BsuRI	GGCC	2 cut(s)	78, 615
BsuTUI	ATCGAT	1 cut(s)	228
BtsCI	GGATG	5 cut(s)	588, 679, 924, 1168, 1329
BtsI	GCAGTG	1 cut(s)	1188
BtsIMutI	CAGTG	2 cut(s)	438, 1188
Cac8I	GCNNGC	1 cut(s)	1251
Cfr13I	GGNCC	1 cut(s)	752
ClaI	ATCGAT	1 cut(s)	228
CseI	GACGC	1 cut(s)	1300
DdeI	CTNAG	8 cut(s)	123, 159, 473, 622, 1008, 1173, 1548, 1609
DpnI	GATC	6 cut(s)	390, 430, 781, 801, 1026, 1056
DpnII	GATC	6 cut(s)	388, 428, 779, 799, 1024, 1054
Eam1104I	CTCTTC	3 cut(s)	6, 1731, 1734
EarI	CTCTTC	3 cut(s)	6, 1731, 1734
EciI	GGCGGA	1 cut(s)	1316
Eco130I	CCWWGG	3 cut(s)	616, 1414, 1567
Eco47I	GGWCC	1 cut(s)	752
Eco57I	CTGAAG	3 cut(s)	72, 630, 900
EcoNI	CCTNNNNNAGG	1 cut(s)	1376
EcoO109I	RGGNCCY	1 cut(s)	752
EcoRI	GAATTC	2 cut(s)	1034, 1536
EcoRII	CCWGG	2 cut(s)	754, 1332
EcoT14I	CCWWGG	3 cut(s)	616, 1414, 1567
EcoT22I	ATGCAT	1 cut(s)	1170
ErhI	CCWWGG	3 cut(s)	616, 1414, 1567
Esp3I	CGTCTC	1 cut(s)	343
FalI	AAGNNNNNCTT	4 cut(s)	846, 878, 1415, 1447
FbaI	TGATCA	1 cut(s)	388
FblI	GTMKAC	1 cut(s)	1317
FokI	GGATG	5 cut(s)	575, 686, 911, 1155, 1316
FspBI	CTAG	9 cut(s)	257, 345, 900, 918, 1089, 1152, 1415, 1460, 1556
GsuI	CTGGAG	1 cut(s)	1089
HaeIII	GGCC	2 cut(s)	78, 615
HgaI	GACGC	1 cut(s)	1300
HincII	GTYRAC	1 cut(s)	1617
HindII	GTYRAC	1 cut(s)	1617
HindIII	AAGCTT	1 cut(s)	959
HinfI	GANTC	5 cut(s)	14, 435, 872, 1552, 1563
HpaI	GTTAAC	1 cut(s)	1617
HphI	GGTGA	4 cut(s)	227, 523, 556, 809
Hpy166II	GTNNAC	4 cut(s)	281, 1086, 1318, 1617
Hpy188I	TCNGA	8 cut(s)	124, 610, 625, 695, 777, 880, 954, 1040
Hpy8I	GTNNAC	4 cut(s)	281, 1086, 1318, 1617
Hpy99I	CGWCG	1 cut(s)	1316
HpyAV	CCTTC	2 cut(s)	325, 605
HpyCH4III	ACNGT	3 cut(s)	151, 442, 1083
HpyCH4V	TGCA	7 cut(s)	446, 458, 769, 1130, 1168, 1193, 1710
HpyF10VI	GCNNNNNNNGC	1 cut(s)	84
HpyF3I	CTNAG	8 cut(s)	123, 159, 473, 622, 1008, 1173, 1548, 1609
Ksp22I	TGATCA	1 cut(s)	388
KspAI	GTTAAC	1 cut(s)	1617
Kzo9I	GATC	6 cut(s)	388, 428, 779, 799, 1024, 1054
LmnI	GCTCC	2 cut(s)	1108, 1258
LweI	GCATC	3 cut(s)	1155, 1177, 1534
MaeI	CTAG	9 cut(s)	257, 345, 900, 918, 1089, 1152, 1415, 1460, 1556
MaeIII	GTNAC	1 cut(s)	508
MalI	GATC	6 cut(s)	390, 430, 781, 801, 1026, 1056
MboI	GATC	6 cut(s)	388, 428, 779, 799, 1024, 1054
MfeI	CAATTG	1 cut(s)	89
MflI	RGATCY	1 cut(s)	1054
MlyI	GAGTC	2 cut(s)	23, 1561
MmeI	TCCRAC	2 cut(s)	679, 1519
Mph1103I	ATGCAT	1 cut(s)	1170
MroXI	GAANNNNTTC	2 cut(s)	264, 1430
MseI	TTAA	2 cut(s)	1073, 1616
MslI	CAYNNNNRTG	2 cut(s)	408, 1374
MspR9I	CCNGG	2 cut(s)	756, 1334
MunI	CAATTG	1 cut(s)	89
Mva1269I	GAATGC	3 cut(s)	44, 985, 1109
MvaI	CCWGG	2 cut(s)	756, 1334
MwoI	GCNNNNNNNGC	1 cut(s)	84
NdeII	GATC	6 cut(s)	388, 428, 779, 799, 1024, 1054
NlaIV	GGNNCC	1 cut(s)	180
NsiI	ATGCAT	1 cut(s)	1170
NspI	RCATGY	2 cut(s)	413, 1298
PctI	GAATGC	3 cut(s)	44, 985, 1109
PdmI	GAANNNNTTC	2 cut(s)	264, 1430
PfeI	GAWTC	3 cut(s)	435, 872, 1563
PleI	GAGTC	2 cut(s)	22, 1560
PpsI	GAGTC	2 cut(s)	22, 1560
PpuMI	RGGWCCY	1 cut(s)	752
PshBI	ATTAAT	1 cut(s)	1073
Psp5II	RGGWCCY	1 cut(s)	752
Psp6I	CCWGG	2 cut(s)	754, 1332
PspGI	CCWGG	2 cut(s)	754, 1332
PspN4I	GGNNCC	1 cut(s)	180
PspPI	GGNCC	1 cut(s)	752
PspPPI	RGGWCCY	1 cut(s)	752
PsuI	RGATCY	1 cut(s)	1054
RseI	CAYNNNNRTG	2 cut(s)	408, 1374
SaqAI	TTAA	2 cut(s)	1073, 1616
Sau3AI	GATC	6 cut(s)	388, 428, 779, 799, 1024, 1054
Sau96I	GGNCC	1 cut(s)	752
SchI	GAGTC	2 cut(s)	23, 1561
ScrFI	CCNGG	2 cut(s)	756, 1334
SfaNI	GCATC	3 cut(s)	1155, 1177, 1534
SinI	GGWCC	1 cut(s)	752
SmiMI	CAYNNNNRTG	2 cut(s)	408, 1374
SmlI	CTYRAG	2 cut(s)	306, 941
SmoI	CTYRAG	2 cut(s)	306, 941
SpeI	ACTAGT	2 cut(s)	344, 899
SsiI	CCGC	1 cut(s)	1301
SspI	AATATT	1 cut(s)	1263
SspMI	CTAG	9 cut(s)	257, 345, 900, 918, 1089, 1152, 1415, 1460, 1556
StyD4I	CCNGG	2 cut(s)	754, 1332
StyI	CCWWGG	3 cut(s)	616, 1414, 1567
TaaI	ACNGT	3 cut(s)	151, 442, 1083
TaqI	TCGA	3 cut(s)	228, 329, 1443
TaqII	GACCGA	1 cut(s)	738
TfiI	GAWTC	3 cut(s)	435, 872, 1563
Tru1I	TTAA	2 cut(s)	1073, 1616
Tru9I	TTAA	2 cut(s)	1073, 1616
TscAI	CASTG	2 cut(s)	445, 1195
TspRI	CASTG	2 cut(s)	445, 1195
VpaK11BI	GGWCC	1 cut(s)	752
VspI	ATTAAT	1 cut(s)	1073
XagI	CCTNNNNNAGG	1 cut(s)	1376
XapI	RAATTY	4 cut(s)	380, 821, 1034, 1536
XbaI	TCTAGA	1 cut(s)	1555
XceI	RCATGY	2 cut(s)	413, 1298
XmaJI	CCTAGG	1 cut(s)	1414
XmiI	GTMKAC	1 cut(s)	1317
XmnI	GAANNNNTTC	2 cut(s)	264, 1430
XspI	CTAG	9 cut(s)	257, 345, 900, 918, 1089, 1152, 1415, 1460, 1556
Zsp2I	ATGCAT	1 cut(s)	1170

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.