Rmu_sc0003187.1_g000014

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003187.1
Physical Location & Seq
Forward (+)
57392 .. 57934
543 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003187.1_g000014.1.cds

Sequence Viewer

Length: 543 bp
atgtcttcttatcaggtgaaccctgatacattcgtttgtgactactgcctatgtcacgaaaagaatgttctccctatgttttgtgaagagtcaaaaaagacttatcacaaggaatgcttcatagctgaagcaagaagaaaaaccaagaatggccttgtcagccaactggtagaacaagaatacgaagaatatttctctgaacaaaaagagaaagaagtagaaactttgttccaaaaaatcatggaaccatcttcctcaaaaataaaggaagaaatcatcgatgaagaaaaaatcgatggaaatgaaaattttgaactggttgaaccaccagaaattgttctagaagaatgtaaaccattcattccaaaggaacaagctcaagaaaatgagattcaacaatcgaaagtcgtatctactagtagatgcagcaactacatagagattggactgaaattcccagatcataaaaaatatcatctacatgcctttgtagataatggatcaggatttactgttgcaaagagatttgcaattccagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

180

Amino Acids

21.03

Weight (kDa)

4.99

Isoelectric Point (pI)

61.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 508
AcsI RAATTY 2 cut(s) 307, 452
AcuI CTGAAG 1 cut(s) 147
AgsI TTSAA 3 cut(s) 314, 323, 395
AhlI ACTAGT 1 cut(s) 416
AluBI AGCT 2 cut(s) 125, 377
AluI AGCT 2 cut(s) 125, 377
AlwI GGATC 1 cut(s) 508
AoxI GGCC 1 cut(s) 151
ApeKI GCWGC 1 cut(s) 426
ApoI RAATTY 2 cut(s) 307, 452
Asp700I GAANNNNTTC 1 cut(s) 336
AsuHPI GGTGA 1 cut(s) 28
BaeI ACNNNNGTAYC 2 cut(s) 18, 51
BbvI GCAGC 1 cut(s) 438
BccI CCATC 2 cut(s) 256, 290
BcuI ACTAGT 1 cut(s) 416
BfaI CTAG 2 cut(s) 341, 417
BisI GCNGC 1 cut(s) 427
BlsI GCNGC 1 cut(s) 428
BmiI GGNNCC 1 cut(s) 246
BmsI GCATC 1 cut(s) 413
BpuEI CTTGAG 1 cut(s) 363
Bsa29I ATCGAT 2 cut(s) 279, 294
Bse1I ACTGG 2 cut(s) 171, 321
BseCI ATCGAT 2 cut(s) 279, 294
BseNI ACTGG 2 cut(s) 171, 321
BseXI GCAGC 1 cut(s) 438
BshFI GGCC 1 cut(s) 153
BshVI ATCGAT 2 cut(s) 279, 294
BsmI GAATGC 1 cut(s) 119
BsnI GGCC 1 cut(s) 153
Bsp143I GATC 2 cut(s) 460, 500
BspANI GGCC 1 cut(s) 153
BspDI ATCGAT 2 cut(s) 279, 294
BspLI GGNNCC 1 cut(s) 246
BspPI GGATC 1 cut(s) 508
BsrI ACTGG 2 cut(s) 171, 321
BssMI GATC 2 cut(s) 460, 500
Bst4CI ACNGT 1 cut(s) 514
Bst6I CTCTTC 1 cut(s) 81
BstKTI GATC 2 cut(s) 463, 503
BstMBI GATC 2 cut(s) 460, 500
BstMWI GCNNNNNNNGC 1 cut(s) 159
BstNSI RCATGY 1 cut(s) 485
BstV1I GCAGC 1 cut(s) 438
Bsu15I ATCGAT 2 cut(s) 279, 294
BsuRI GGCC 1 cut(s) 153
BsuTUI ATCGAT 2 cut(s) 279, 294
ClaI ATCGAT 2 cut(s) 279, 294
CviAII CATG 2 cut(s) 241, 482
CviJI RGCY 4 cut(s) 125, 153, 162, 377
CviKI_1 RGCY 4 cut(s) 125, 153, 162, 377
DpnI GATC 2 cut(s) 462, 502
DpnII GATC 2 cut(s) 460, 500
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 147
FaeI CATG 2 cut(s) 244, 485
FaiI YATR 7 cut(s) 52, 77, 122, 242, 437, 465, 483
FalI AAGNNNNNCTT 2 cut(s) 101, 133
FatI CATG 2 cut(s) 240, 481
Fnu4HI GCNGC 1 cut(s) 427
Fsp4HI GCNGC 1 cut(s) 427
FspBI CTAG 2 cut(s) 341, 417
GluI GCNGC 1 cut(s) 427
HaeIII GGCC 1 cut(s) 153
Hin1II CATG 2 cut(s) 244, 485
HinfI GANTC 2 cut(s) 89, 391
HphI GGTGA 1 cut(s) 28
Hpy166II GTNNAC 2 cut(s) 19, 353
Hpy188I TCNGA 1 cut(s) 199
Hpy188III TCNNGA 5 cut(s) 56, 341, 380, 504, 536
Hpy8I GTNNAC 2 cut(s) 19, 353
HpyCH4III ACNGT 1 cut(s) 514
HpyCH4V TGCA 3 cut(s) 426, 518, 530
HpyF10VI GCNNNNNNNGC 1 cut(s) 159
Hsp92II CATG 2 cut(s) 244, 485
Kzo9I GATC 2 cut(s) 460, 500
LpnPI CCDG 6 cut(s) 36, 152, 302, 342, 471, 489
Lsp1109I GCAGC 1 cut(s) 438
LweI GCATC 1 cut(s) 413
MaeI CTAG 2 cut(s) 341, 417
MaeIII GTNAC 2 cut(s) 38, 53
MalI GATC 2 cut(s) 462, 502
MboI GATC 2 cut(s) 460, 500
MboII GAAGA 7 cut(s) 98, 147, 197, 243, 281, 296, 356
MluCI AATT 4 cut(s) 307, 333, 452, 531
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 1 cut(s) 265
MroXI GAANNNNTTC 1 cut(s) 336
MslI CAYNNNNRTG 1 cut(s) 480
Mva1269I GAATGC 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 159
NdeII GATC 2 cut(s) 460, 500
NlaIII CATG 2 cut(s) 244, 485
NlaIV GGNNCC 1 cut(s) 246
NmuCI GTSAC 2 cut(s) 38, 53
NspI RCATGY 1 cut(s) 485
PctI GAATGC 1 cut(s) 119
PdmI GAANNNNTTC 1 cut(s) 336
PfeI GAWTC 1 cut(s) 391
PkrI GCNGC 1 cut(s) 428
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 246
RseI CAYNNNNRTG 1 cut(s) 480
SatI GCNGC 1 cut(s) 427
Sau3AI GATC 2 cut(s) 460, 500
SchI GAGTC 1 cut(s) 98
SetI ASST 3 cut(s) 18, 127, 379
SfaNI GCATC 1 cut(s) 413
SmiMI CAYNNNNRTG 1 cut(s) 480
SmlI CTYRAG 1 cut(s) 378
SmoI CTYRAG 1 cut(s) 378
SpeI ACTAGT 1 cut(s) 416
Sse9I AATT 4 cut(s) 307, 333, 452, 531
SspI AATATT 1 cut(s) 191
SspMI CTAG 2 cut(s) 341, 417
TaaI ACNGT 1 cut(s) 514
TaqI TCGA 3 cut(s) 279, 294, 401
TasI AATT 4 cut(s) 307, 333, 452, 531
TfiI GAWTC 1 cut(s) 391
TseFI GTSAC 2 cut(s) 38, 53
TseI GCWGC 1 cut(s) 426
Tsp45I GTSAC 2 cut(s) 38, 53
TspDTI ATGAA 4 cut(s) 109, 297, 318, 349
XapI RAATTY 2 cut(s) 307, 452
XbaI TCTAGA 1 cut(s) 340
XceI RCATGY 1 cut(s) 485
XmnI GAANNNNTTC 1 cut(s) 336
XspI CTAG 2 cut(s) 341, 417
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.