Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000388.1

Orthogroup ID

OG0001755

Physical Location & Seq

Genomic Coordinates Forward (+)

265986 .. 268347

Gene Structure 2362 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000388.1_g000053.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1053 bp

atgattggagaactagagaatactaatctagtcaaccttttgcacagaaaactccctgaactatggagaacagctgtgaaagaaagcatagctgaaaaaccaattgaaagattttcagttggaggaattgccgacagaatcaggcaattactaaaagagcaatgtaaagccaatcgtagagctaagatggccaagaaacaactcaaaggagttgaaaatttctgttatggaatactggatatgccaaccaattggggatgtcatgaatccaaaaccttggaaacagcaaacacgaagggctacgaaatagcctattctgatgatgaagatgatgataggtcagtatgctctgcctggtctgaagaagaagaatcatctgattttgaaatagattctgaagtagagtacttggaatctagaaagatgaacgttccacacatcaaaaactgggaagaaagtaagacggaagcaataacgtcttcttaccaggtgaaccctggtacattcgtttgtgactactgcctatgtcacaaaaagaatagacttcctatgttctatgaaatgtctaaaaagacttatcacaaagaatgcttcatagctgaagcaagaagaaagaccaaaaatggccttgtcagccaattggtagaacaagaatatgaagaatatttctctgagaaaaaagagaaagaaatagaaaaaatgttccaagaagctatggaatcctcttcctcaaagattaaggaagaaaaaatcgacgaacaaaaactcgatataaaagaagaaaaaattgaggaagaaaaactcgatacaactatagaactggttgaaataccagaaactggtccaaaagaatgtaaaccattcatacgtcaggaacaagctcaagaaaatgagcttcaacaatcgaaagtcgtctctactagtaggtacaacaactacatagagattggactcaaattccctgatcacaaaaaatatcatctacttgcctttgtagataatggatcaggatttacagttgcaaagaaatttgcaattctagaagaactctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

350

Amino Acids

40.86

Weight (kDa)

5.21

Isoelectric Point (pI)

61.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001755)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g21631 FvH4_2g10222 FvH4_4g24921 FvH4_6g05922 FvH4_6g25072
rosa_chinensis	RchiOBHm_Chr2g0093451
rosa_laevigata	RLG00000022539 RLG00000034490 RLG00000034528
rosa_multiflora	Rmu_sc0000399.1_g000026 Rmu_sc0000770.1_g000030 Rmu_sc0001851.1_g000051 Rmu_sc0002187.1_g000007 Rmu_sc0002285.1_g000023 Rmu_sc0002691.1_g000038 Rmu_sc0002818.1_g000001 Rmu_sc0002845.1_g000027 Rmu_sc0003187.1_g000014 Rmu_sc0003249.1_g000027 Rmu_sc0003467.1_g000008 Rmu_sc0004510.1_g000016 Rmu_sc0004908.1_g000009 Rmu_sc0005069.1_g000025 Rmu_sc0006196.1_g000002 Rmu_sc0006361.1_g000017 Rmu_sc0006416.1_g000013 Rmu_sc0006682.1_g000001 Rmu_sc0010379.1_g000007 Rmu_sc0010686.1_g000001 Rmu_sc0013208.1_g000001 Rmu_sc0022212.1_g000001 Rmu_sc0025570.1_g000001 Rmu_sc0027653.1_g000001 Rmu_sc0029502.1_g000001 Rmu_sc0035757.1_g000001 Rmu_ssc0000052.1_g000013 Rmu_ssc0000053.1_g000013 Rmu_ssc0000388.1_g000053 Rmu_ssc0000397.1_g000010
rosa_rugosa	Rorug05G0492200 Rorug07G0333400
rosa_samantha	Rh5BG353500 Rh6DG255600 Rh7BG334600
rosa_wichuraiana	Rw0G020000 Rw1G017190 Rw3G026880 Rw4G005210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	839
AclI	AACGTT	1 cut(s)	429
AclWI	GGATC	1 cut(s)	1012
AcoI	YGGCCR	1 cut(s)	189
AcsI	RAATTY	3 cut(s)	217, 956, 1028
AcuI	CTGAAG	3 cut(s)	381, 417, 621
AfaI	GTAC	3 cut(s)	407, 502, 929
AfiI	CCNNNNNNNGG	1 cut(s)	839
AgsI	TTSAA	5 cut(s)	107, 215, 386, 827, 899
AhlI	ACTAGT	1 cut(s)	920
AjnI	CCWGG	3 cut(s)	353, 486, 496
AluBI	AGCT	7 cut(s)	74, 92, 182, 599, 713, 881, 895
AluI	AGCT	7 cut(s)	74, 92, 182, 599, 713, 881, 895
Alw26I	GTCTC	1 cut(s)	919
AlwI	GGATC	1 cut(s)	1012
AlwNI	CAGNNNCTG	1 cut(s)	839
AoxI	GGCC	2 cut(s)	189, 625
ApoI	RAATTY	3 cut(s)	217, 956, 1028
AspS9I	GGNCC	1 cut(s)	842
AsuHPI	GGTGA	1 cut(s)	502
AvaII	GGWCC	1 cut(s)	842
BaeI	ACNNNNGTAYC	2 cut(s)	492, 525
BalI	TGGCCA	1 cut(s)	191
BbsI	GAAGAC	1 cut(s)	471
BccI	CCATC	1 cut(s)	181
BciT130I	CCWGG	3 cut(s)	355, 488, 498
BclI	TGATCA	1 cut(s)	964
BcoDI	GTCTC	1 cut(s)	919
BcuI	ACTAGT	1 cut(s)	920
BfaI	CTAG	6 cut(s)	14, 29, 417, 921, 1040, 1051
BfmI	CTRYAG	1 cut(s)	813
BmcAI	AGTACT	1 cut(s)	407
Bme1390I	CCNGG	3 cut(s)	355, 488, 498
Bme18I	GGWCC	1 cut(s)	842
BmgT120I	GGNCC	1 cut(s)	842
BmrFI	CCNGG	3 cut(s)	355, 488, 498
BmrI	ACTGGG	1 cut(s)	457
BmuI	ACTGGG	1 cut(s)	457
BpiI	GAAGAC	1 cut(s)	471
BpuEI	CTTGAG	1 cut(s)	867
BsaJI	CCNNGG	2 cut(s)	276, 496
Bsc4I	CCNNNNNNNGG	1 cut(s)	839
Bse1I	ACTGG	4 cut(s)	240, 452, 825, 844
Bse3DI	GCAATG	1 cut(s)	167
BseBI	CCWGG	3 cut(s)	355, 488, 498
BseDI	CCNNGG	2 cut(s)	276, 496
BseGI	GGATG	1 cut(s)	263
BseLI	CCNNNNNNNGG	1 cut(s)	839
BseMI	GCAATG	1 cut(s)	167
BseMII	CTCAG	1 cut(s)	663
BseNI	ACTGG	4 cut(s)	240, 452, 825, 844
BshFI	GGCC	2 cut(s)	191, 627
BslI	CCNNNNNNNGG	1 cut(s)	839
BsmAI	GTCTC	1 cut(s)	919
BsmBI	CGTCTC	1 cut(s)	919
BsmI	GAATGC	1 cut(s)	593
BsnI	GGCC	2 cut(s)	191, 627
Bsp143I	GATC	2 cut(s)	964, 1004
BspANI	GGCC	2 cut(s)	191, 627
BspCNI	CTCAG	1 cut(s)	664
BspHI	TCATGA	1 cut(s)	262
BspPI	GGATC	1 cut(s)	1012
BsrDI	GCAATG	1 cut(s)	167
BsrI	ACTGG	4 cut(s)	240, 452, 825, 844
BssECI	CCNNGG	2 cut(s)	276, 496
BssMI	GATC	2 cut(s)	964, 1004
BssT1I	CCWWGG	1 cut(s)	276
Bst2UI	CCWGG	3 cut(s)	355, 488, 498
Bst4CI	ACNGT	1 cut(s)	1018
Bst6I	CTCTTC	1 cut(s)	730
BstDEI	CTNAG	2 cut(s)	183, 672
BstF5I	GGATG	1 cut(s)	263
BstKTI	GATC	2 cut(s)	967, 1007
BstMAI	GTCTC	1 cut(s)	919
BstMBI	GATC	2 cut(s)	964, 1004
BstMWI	GCNNNNNNNGC	2 cut(s)	188, 633
BstNI	CCWGG	3 cut(s)	355, 488, 498
BstSCI	CCNGG	3 cut(s)	353, 486, 496
BstSFI	CTRYAG	1 cut(s)	813
BstV2I	GAAGAC	1 cut(s)	471
BstXI	CCANNNNNNTGG	2 cut(s)	252, 277
BsuRI	GGCC	2 cut(s)	191, 627
BtsCI	GGATG	1 cut(s)	263
CaiI	CAGNNNCTG	1 cut(s)	839
CciI	TCATGA	1 cut(s)	262
Cfr13I	GGNCC	1 cut(s)	842
CsiI	ACCWGGT	1 cut(s)	486
Csp6I	GTAC	3 cut(s)	406, 501, 928
CviAII	CATG	1 cut(s)	263
CviQI	GTAC	3 cut(s)	406, 501, 928
DdeI	CTNAG	2 cut(s)	183, 672
DpnI	GATC	2 cut(s)	966, 1006
DpnII	GATC	2 cut(s)	964, 1004
EaeI	YGGCCR	1 cut(s)	189
Eam1104I	CTCTTC	1 cut(s)	730
EarI	CTCTTC	1 cut(s)	730
Eco130I	CCWWGG	1 cut(s)	276
Eco47I	GGWCC	1 cut(s)	842
Eco57I	CTGAAG	3 cut(s)	381, 417, 621
EcoRII	CCWGG	3 cut(s)	353, 486, 496
EcoT14I	CCWWGG	1 cut(s)	276
ErhI	CCWWGG	1 cut(s)	276
Esp3I	CGTCTC	1 cut(s)	919
FaeI	CATG	1 cut(s)	266
FatI	CATG	1 cut(s)	262
FbaI	TGATCA	1 cut(s)	964
FokI	GGATG	1 cut(s)	270
FspBI	CTAG	6 cut(s)	14, 29, 417, 921, 1040, 1051
HaeIII	GGCC	2 cut(s)	191, 627
Hin1II	CATG	1 cut(s)	266
HincII	GTYRAC	1 cut(s)	34
HindII	GTYRAC	1 cut(s)	34
HinfI	GANTC	7 cut(s)	138, 266, 371, 392, 413, 719, 951
HphI	GGTGA	1 cut(s)	502
Hpy166II	GTNNAC	3 cut(s)	34, 493, 857
Hpy188I	TCNGA	5 cut(s)	319, 361, 379, 397, 673
Hpy188III	TCNNGA	6 cut(s)	263, 417, 872, 884, 1008, 1040
Hpy8I	GTNNAC	3 cut(s)	34, 493, 857
Hpy99I	CGWCG	1 cut(s)	758
HpyAV	CCTTC	1 cut(s)	289
HpyCH4III	ACNGT	1 cut(s)	1018
HpyCH4IV	ACGT	3 cut(s)	429, 476, 868
HpyCH4V	TGCA	3 cut(s)	43, 1022, 1034
HpyF10VI	GCNNNNNNNGC	2 cut(s)	188, 633
HpyF3I	CTNAG	2 cut(s)	183, 672
HpySE526I	ACGT	3 cut(s)	429, 476, 868
Hsp92II	CATG	1 cut(s)	266
Ksp22I	TGATCA	1 cut(s)	964
Kzo9I	GATC	2 cut(s)	964, 1004
MabI	ACCWGGT	1 cut(s)	486
MaeI	CTAG	6 cut(s)	14, 29, 417, 921, 1040, 1051
MaeII	ACGT	3 cut(s)	429, 476, 868
MaeIII	GTNAC	2 cut(s)	512, 527
MalI	GATC	2 cut(s)	966, 1006
MboI	GATC	2 cut(s)	964, 1004
MfeI	CAATTG	3 cut(s)	102, 250, 638
MlsI	TGGCCA	1 cut(s)	191
MluNI	TGGCCA	1 cut(s)	191
MlyI	GAGTC	1 cut(s)	945
MmeI	TCCRAC	1 cut(s)	100
MnlI	CCTC	4 cut(s)	116, 733, 739, 784
Mox20I	TGGCCA	1 cut(s)	191
MscI	TGGCCA	1 cut(s)	191
MseI	TTAA	1 cut(s)	738
Msp20I	TGGCCA	1 cut(s)	191
MspA1I	CMGCKG	1 cut(s)	74
MspR9I	CCNGG	3 cut(s)	355, 488, 498
MunI	CAATTG	3 cut(s)	102, 250, 638
Mva1269I	GAATGC	1 cut(s)	593
MvaI	CCWGG	3 cut(s)	355, 488, 498
MwoI	GCNNNNNNNGC	2 cut(s)	188, 633
NdeII	GATC	2 cut(s)	964, 1004
NlaIII	CATG	1 cut(s)	266
NmuCI	GTSAC	2 cut(s)	512, 527
PagI	TCATGA	1 cut(s)	262
PctI	GAATGC	1 cut(s)	593
PfeI	GAWTC	6 cut(s)	138, 266, 371, 392, 413, 719
PflMI	CCANNNNNTGG	1 cut(s)	839
PleI	GAGTC	1 cut(s)	945
PpsI	GAGTC	1 cut(s)	945
Psp1406I	AACGTT	1 cut(s)	429
Psp6I	CCWGG	3 cut(s)	353, 486, 496
PspGI	CCWGG	3 cut(s)	353, 486, 496
PspPI	GGNCC	1 cut(s)	842
PstNI	CAGNNNCTG	1 cut(s)	839
PvuII	CAGCTG	1 cut(s)	74
RsaI	GTAC	3 cut(s)	407, 502, 929
RsaNI	GTAC	3 cut(s)	406, 501, 928
SaqAI	TTAA	1 cut(s)	738
Sau3AI	GATC	2 cut(s)	964, 1004
Sau96I	GGNCC	1 cut(s)	842
ScaI	AGTACT	1 cut(s)	407
SchI	GAGTC	1 cut(s)	945
ScrFI	CCNGG	3 cut(s)	355, 488, 498
SexAI	ACCWGGT	1 cut(s)	486
SfcI	CTRYAG	1 cut(s)	813
SinI	GGWCC	1 cut(s)	842
SmlI	CTYRAG	1 cut(s)	882
SmoI	CTYRAG	1 cut(s)	882
SpeI	ACTAGT	1 cut(s)	920
SspI	AATATT	1 cut(s)	665
SspMI	CTAG	6 cut(s)	14, 29, 417, 921, 1040, 1051
StyD4I	CCNGG	3 cut(s)	353, 486, 496
StyI	CCWWGG	1 cut(s)	276
TaaI	ACNGT	1 cut(s)	1018
TaiI	ACGT	3 cut(s)	432, 479, 871
TaqI	TCGA	4 cut(s)	753, 768, 804, 905
TatI	WGTACW	1 cut(s)	405
TfiI	GAWTC	6 cut(s)	138, 266, 371, 392, 413, 719
Tru1I	TTAA	1 cut(s)	738
Tru9I	TTAA	1 cut(s)	738
TseFI	GTSAC	2 cut(s)	512, 527
Tsp45I	GTSAC	2 cut(s)	512, 527
TspDTI	ATGAA	7 cut(s)	279, 339, 440, 573, 583, 672, 853
TspGWI	ACGGA	1 cut(s)	479
Van91I	CCANNNNNTGG	1 cut(s)	839
VpaK11BI	GGWCC	1 cut(s)	842
XapI	RAATTY	3 cut(s)	217, 956, 1028
XbaI	TCTAGA	2 cut(s)	416, 1039
XcmI	CCANNNNNNNNNTGG	1 cut(s)	494
XspI	CTAG	6 cut(s)	14, 29, 417, 921, 1040, 1051
ZrmI	AGTACT	1 cut(s)	407

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.