Rmu_sc0006682.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006682.1
Physical Location & Seq
Reverse (-)
4030 .. 4332
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006682.1_g000001.1.cds

Sequence Viewer

Length: 303 bp
atggaaccatcttcctcaaaagtaaaagaagaagaaatcgatgaagaaaaaatcgatgaaaatattgaactggttgaaccaccagaaattgttccagaagaatgcaaaccattcataccaaaagaacaagctcaagaaaaagagcttcaacaatcgaaagtcttctctactagtagatacagcaactacatagagattagactaaaattccctgatcacaagaaatatcatctacatgcctttgtagataacggatcgggatttactgttgcaaaaagatttgcaattccagaagaactctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.69

Weight (kDa)

4.9

Isoelectric Point (pI)

83.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 262
AcsI RAATTY 1 cut(s) 206
AgsI TTSAA 3 cut(s) 68, 77, 149
AhlI ACTAGT 1 cut(s) 170
AluBI AGCT 2 cut(s) 131, 145
AluI AGCT 2 cut(s) 131, 145
AlwI GGATC 1 cut(s) 262
ApoI RAATTY 1 cut(s) 206
Asp700I GAANNNNTTC 2 cut(s) 90, 161
BbsI GAAGAC 1 cut(s) 154
BccI CCATC 1 cut(s) 16
BclI TGATCA 1 cut(s) 214
BcuI ACTAGT 1 cut(s) 170
BfaI CTAG 2 cut(s) 171, 301
BmiI GGNNCC 1 cut(s) 6
BpiI GAAGAC 1 cut(s) 154
BpuEI CTTGAG 1 cut(s) 117
Bsa29I ATCGAT 2 cut(s) 39, 54
Bse1I ACTGG 1 cut(s) 75
BseCI ATCGAT 2 cut(s) 39, 54
BseNI ACTGG 1 cut(s) 75
BshVI ATCGAT 2 cut(s) 39, 54
BsmI GAATGC 1 cut(s) 107
Bsp143I GATC 2 cut(s) 214, 254
BspDI ATCGAT 2 cut(s) 39, 54
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 262
BsrI ACTGG 1 cut(s) 75
BssMI GATC 2 cut(s) 214, 254
Bst4CI ACNGT 1 cut(s) 268
BstKTI GATC 2 cut(s) 217, 257
BstMBI GATC 2 cut(s) 214, 254
BstNSI RCATGY 1 cut(s) 239
BstV2I GAAGAC 1 cut(s) 154
Bsu15I ATCGAT 2 cut(s) 39, 54
BsuTUI ATCGAT 2 cut(s) 39, 54
ClaI ATCGAT 2 cut(s) 39, 54
CviAII CATG 1 cut(s) 236
CviJI RGCY 2 cut(s) 131, 145
CviKI_1 RGCY 2 cut(s) 131, 145
DpnI GATC 2 cut(s) 216, 256
DpnII GATC 2 cut(s) 214, 254
FaeI CATG 1 cut(s) 239
FaiI YATR 3 cut(s) 116, 191, 237
FatI CATG 1 cut(s) 235
FbaI TGATCA 1 cut(s) 214
FspBI CTAG 2 cut(s) 171, 301
Hin1II CATG 1 cut(s) 239
Hpy188III TCNNGA 4 cut(s) 95, 134, 258, 290
HpyCH4III ACNGT 1 cut(s) 268
HpyCH4V TGCA 3 cut(s) 105, 272, 284
Hsp92II CATG 1 cut(s) 239
Ksp22I TGATCA 1 cut(s) 214
Kzo9I GATC 2 cut(s) 214, 254
LpnPI CCDG 4 cut(s) 56, 96, 108, 225
MaeI CTAG 2 cut(s) 171, 301
MalI GATC 2 cut(s) 216, 256
MboI GATC 2 cut(s) 214, 254
MboII GAAGA 6 cut(s) 3, 41, 44, 56, 110, 154
MluCI AATT 3 cut(s) 87, 206, 285
MnlI CCTC 1 cut(s) 25
MroXI GAANNNNTTC 2 cut(s) 90, 161
MslI CAYNNNNRTG 1 cut(s) 234
Mva1269I GAATGC 1 cut(s) 107
NdeII GATC 2 cut(s) 214, 254
NlaIII CATG 1 cut(s) 239
NlaIV GGNNCC 1 cut(s) 6
NspI RCATGY 1 cut(s) 239
PctI GAATGC 1 cut(s) 107
PdmI GAANNNNTTC 2 cut(s) 90, 161
PspN4I GGNNCC 1 cut(s) 6
RseI CAYNNNNRTG 1 cut(s) 234
Sau3AI GATC 2 cut(s) 214, 254
SetI ASST 2 cut(s) 133, 147
SmiMI CAYNNNNRTG 1 cut(s) 234
SmlI CTYRAG 1 cut(s) 132
SmoI CTYRAG 1 cut(s) 132
SpeI ACTAGT 1 cut(s) 170
Sse9I AATT 3 cut(s) 87, 206, 285
SspI AATATT 1 cut(s) 64
SspMI CTAG 2 cut(s) 171, 301
TaaI ACNGT 1 cut(s) 268
TaqI TCGA 3 cut(s) 39, 54, 155
TasI AATT 3 cut(s) 87, 206, 285
TspDTI ATGAA 3 cut(s) 57, 72, 103
TspGWI ACGGA 1 cut(s) 267
XapI RAATTY 1 cut(s) 206
XceI RCATGY 1 cut(s) 239
XmnI GAANNNNTTC 2 cut(s) 90, 161
XspI CTAG 2 cut(s) 171, 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.