Rmu_sc0006416.1_g000013

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006416.1
Physical Location & Seq
Forward (+)
35260 .. 35706
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006416.1_g000013.1.cds

Sequence Viewer

Length: 447 bp
atgtcttcttatcaggtgaatcctggtacattcgtttgtgactactgcttgtgtcacgaaaagaatggtctccatatgttttgtgaagaatcgaaaaagaattatcacaaagaatgcttcatagctgaaacaagaagaaaaaccaagaatggccttgtcagccaattggttgaacaagaatatgaagaatatttctctgaacaaaaagagaaagaagaacaaaaagaggtagaaactctgttccaaagaattatggaaccttctcctccatcttcctcaaaaatgaaggaagaaaccatcgatgaagatattgaactggttgacccaccagaaattgttccagaagaatgtaaaccattcattccaaaggaacaagctcaagaaaatgagcttcaacattcgaaattcatctctactagtagatacagcaactacatagagatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

17.52

Weight (kDa)

4.78

Isoelectric Point (pI)

80.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 404
AfaI GTAC 1 cut(s) 28
AgsI TTSAA 3 cut(s) 173, 314, 395
AhlI ACTAGT 1 cut(s) 416
AjnI CCWGG 1 cut(s) 22
AluBI AGCT 3 cut(s) 125, 377, 391
AluI AGCT 3 cut(s) 125, 377, 391
Alw26I GTCTC 1 cut(s) 74
AoxI GGCC 1 cut(s) 151
ApoI RAATTY 1 cut(s) 404
Asp700I GAANNNNTTC 1 cut(s) 336
AsuHPI GGTGA 1 cut(s) 28
AsuII TTCGAA 1 cut(s) 401
BaeI ACNNNNGTAYC 2 cut(s) 18, 51
BccI CCATC 2 cut(s) 277, 305
BciT130I CCWGG 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 74
BcuI ACTAGT 1 cut(s) 416
BfaI CTAG 1 cut(s) 417
Bme1390I CCNGG 1 cut(s) 24
BmiI GGNNCC 1 cut(s) 258
BmrFI CCNGG 1 cut(s) 24
Bpu14I TTCGAA 1 cut(s) 401
BpuEI CTTGAG 1 cut(s) 363
Bsa29I ATCGAT 1 cut(s) 300
BsaI GGTCTC 1 cut(s) 74
Bse1I ACTGG 1 cut(s) 321
BseBI CCWGG 1 cut(s) 24
BseCI ATCGAT 1 cut(s) 300
BseNI ACTGG 1 cut(s) 321
BseRI GAGGAG 1 cut(s) 255
BshFI GGCC 1 cut(s) 153
BshVI ATCGAT 1 cut(s) 300
BsmAI GTCTC 1 cut(s) 74
BsmI GAATGC 1 cut(s) 119
BsnI GGCC 1 cut(s) 153
Bso31I GGTCTC 1 cut(s) 74
Bsp119I TTCGAA 1 cut(s) 401
BspANI GGCC 1 cut(s) 153
BspDI ATCGAT 1 cut(s) 300
BspLI GGNNCC 1 cut(s) 258
BspT104I TTCGAA 1 cut(s) 401
BspTNI GGTCTC 1 cut(s) 74
BsrI ACTGG 1 cut(s) 321
Bst2UI CCWGG 1 cut(s) 24
BstBI TTCGAA 1 cut(s) 401
BstMAI GTCTC 1 cut(s) 74
BstMWI GCNNNNNNNGC 1 cut(s) 159
BstNI CCWGG 1 cut(s) 24
BstSCI CCNGG 1 cut(s) 22
Bsu15I ATCGAT 1 cut(s) 300
BsuRI GGCC 1 cut(s) 153
BsuTUI ATCGAT 1 cut(s) 300
ClaI ATCGAT 1 cut(s) 300
Csp6I GTAC 1 cut(s) 27
CviJI RGCY 5 cut(s) 125, 153, 162, 377, 391
CviKI_1 RGCY 5 cut(s) 125, 153, 162, 377, 391
CviQI GTAC 1 cut(s) 27
Eco31I GGTCTC 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 22
FaiI YATR 6 cut(s) 75, 77, 122, 183, 254, 437
FauNDI CATATG 1 cut(s) 75
FspBI CTAG 1 cut(s) 417
HaeIII GGCC 1 cut(s) 153
HincII GTYRAC 1 cut(s) 322
HindII GTYRAC 1 cut(s) 322
HinfI GANTC 2 cut(s) 19, 89
HphI GGTGA 1 cut(s) 28
Hpy166II GTNNAC 2 cut(s) 322, 353
Hpy188I TCNGA 1 cut(s) 199
Hpy188III TCNNGA 3 cut(s) 56, 341, 380
Hpy8I GTNNAC 2 cut(s) 322, 353
HpyAV CCTTC 2 cut(s) 270, 280
HpyF10VI GCNNNNNNNGC 1 cut(s) 159
LpnPI CCDG 5 cut(s) 9, 36, 302, 342, 354
MaeI CTAG 1 cut(s) 417
MaeIII GTNAC 2 cut(s) 38, 53
MboII GAAGA 8 cut(s) 98, 147, 197, 227, 264, 302, 317, 356
MfeI CAATTG 1 cut(s) 164
MluCI AATT 5 cut(s) 100, 164, 249, 333, 404
MnlI CCTC 3 cut(s) 220, 276, 286
MroXI GAANNNNTTC 1 cut(s) 336
MspR9I CCNGG 1 cut(s) 24
MunI CAATTG 1 cut(s) 164
Mva1269I GAATGC 1 cut(s) 119
MvaI CCWGG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 159
NdeI CATATG 1 cut(s) 75
NlaIV GGNNCC 1 cut(s) 258
NmuCI GTSAC 2 cut(s) 38, 53
NspV TTCGAA 1 cut(s) 401
PctI GAATGC 1 cut(s) 119
PdmI GAANNNNTTC 1 cut(s) 336
PfeI GAWTC 2 cut(s) 19, 89
Psp6I CCWGG 1 cut(s) 22
PspGI CCWGG 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 258
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
ScrFI CCNGG 1 cut(s) 24
SetI ASST 6 cut(s) 18, 127, 231, 262, 379, 393
SfuI TTCGAA 1 cut(s) 401
SmlI CTYRAG 1 cut(s) 378
SmoI CTYRAG 1 cut(s) 378
SpeI ACTAGT 1 cut(s) 416
Sse9I AATT 5 cut(s) 100, 164, 249, 333, 404
SspI AATATT 1 cut(s) 191
SspMI CTAG 1 cut(s) 417
StyD4I CCNGG 1 cut(s) 22
TaqI TCGA 3 cut(s) 92, 300, 401
TasI AATT 5 cut(s) 100, 164, 249, 333, 404
TfiI GAWTC 2 cut(s) 19, 89
TseFI GTSAC 2 cut(s) 38, 53
Tsp45I GTSAC 2 cut(s) 38, 53
TspDTI ATGAA 6 cut(s) 109, 198, 299, 318, 349, 397
XapI RAATTY 1 cut(s) 404
XmnI GAANNNNTTC 1 cut(s) 336
XspI CTAG 1 cut(s) 417
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.