Rmu_sc0010379.1_g000007

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010379.1
OG0001755
Physical Location & Seq
Forward (+)
29326 .. 30108
783 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010379.1_g000007.1.cds

Sequence Viewer

Length: 717 bp
atgtcttcttatcaggtgaaccctggtacattcgtctgtgactactgtttttgtcacgaaaagaatggtctcccaatgtttagtaaagagtctaagaagacctatcacaaagaatgcttcatagctgaagcgagaagaaaaaccaagaatagtcttgtcagccgatgggttgagcaagaatatgaagagtatttcgctgagaaaaaggtgaaaaaagttgaaactctgttccaggaaaccatggaacaaacagaaagagttgaaacaactatgttccaagaaacaaccatggaactatcttcctcagaaataaaggaagaaatcatcggtgaagaaacaatcgctgaagatattgaacttgaagctacggacacatgtgatctacttggccaaccatctggcaagtttgattataaagtcagatatgactctccgtcctggttcaatgagactaacgaaataattcctacagactgggatgagacaaaacccactcaggaaaatattccagaagaatgtaaaccattcattcctcaggaacaagttcaagaaaatgaggttcaacaatcgaaagtcgtctctactagtagatacagcaactacatcgagattggactaaagttccctgatcacaggaaatatcatctacatgcctttgtagataatggatcaggatttactgttgcaaagagatttgcaattccagatgaactctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
G-patch RVT_1 RVT_3 Retrotrans_gag rve

Protein Analysis

238

Amino Acids

27.88

Weight (kDa)

4.76

Isoelectric Point (pI)

58.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 414
AclWI GGATC 1 cut(s) 676
AcoI YGGCCR 1 cut(s) 388
AcuI CTGAAG 2 cut(s) 147, 366
AfaI GTAC 1 cut(s) 28
AflIII ACRYGT 1 cut(s) 374
AgsI TTSAA 7 cut(s) 221, 263, 356, 362, 445, 548, 563
AhdI GACNNNNNGTC 1 cut(s) 433
AhlI ACTAGT 1 cut(s) 584
AjnI CCWGG 3 cut(s) 22, 231, 437
AluBI AGCT 2 cut(s) 125, 365
AluI AGCT 2 cut(s) 125, 365
Alw26I GTCTC 4 cut(s) 74, 443, 476, 583
AlwI GGATC 1 cut(s) 676
AoxI GGCC 1 cut(s) 388
Asp700I GAANNNNTTC 3 cut(s) 462, 504, 543
AsuHPI GGTGA 3 cut(s) 28, 220, 341
AxyI CCTNAGG 1 cut(s) 534
BaeI ACNNNNGTAYC 2 cut(s) 18, 51
BalI TGGCCA 1 cut(s) 390
BbsI GAAGAC 1 cut(s) 104
BccI CCATC 2 cut(s) 159, 403
BcgI CGANNNNNNTGC 2 cut(s) 586, 620
BciT130I CCWGG 3 cut(s) 24, 233, 439
BclI TGATCA 1 cut(s) 628
BcoDI GTCTC 4 cut(s) 74, 443, 476, 583
BcuI ACTAGT 1 cut(s) 584
BfaI CTAG 2 cut(s) 585, 715
BfmI CTRYAG 1 cut(s) 468
Bme1390I CCNGG 3 cut(s) 24, 233, 439
BmeRI GACNNNNNGTC 1 cut(s) 433
BmrFI CCNGG 3 cut(s) 24, 233, 439
BmrI ACTGGG 1 cut(s) 484
BmuI ACTGGG 1 cut(s) 484
BpiI GAAGAC 1 cut(s) 104
BsaI GGTCTC 1 cut(s) 74
BsaJI CCNNGG 3 cut(s) 22, 240, 288
Bse1I ACTGG 1 cut(s) 479
Bse21I CCTNAGG 1 cut(s) 534
BseBI CCWGG 3 cut(s) 24, 233, 439
BseDI CCNNGG 3 cut(s) 22, 240, 288
BseGI GGATG 1 cut(s) 484
BseMII CTCAG 4 cut(s) 189, 318, 509, 548
BseNI ACTGG 1 cut(s) 479
BshFI GGCC 1 cut(s) 390
BsmAI GTCTC 4 cut(s) 74, 443, 476, 583
BsmBI CGTCTC 1 cut(s) 583
BsmI GAATGC 1 cut(s) 119
BsnI GGCC 1 cut(s) 390
Bso31I GGTCTC 1 cut(s) 74
Bsp143I GATC 3 cut(s) 379, 628, 668
Bsp19I CCATGG 2 cut(s) 240, 288
BspANI GGCC 1 cut(s) 390
BspCNI CTCAG 4 cut(s) 190, 317, 508, 547
BspPI GGATC 1 cut(s) 676
BspTNI GGTCTC 1 cut(s) 74
BsrI ACTGG 1 cut(s) 479
BssECI CCNNGG 3 cut(s) 22, 240, 288
BssMI GATC 3 cut(s) 379, 628, 668
BssT1I CCWWGG 2 cut(s) 240, 288
Bst2UI CCWGG 3 cut(s) 24, 233, 439
Bst4CI ACNGT 2 cut(s) 47, 682
Bst6I CTCTTC 1 cut(s) 180
BstDEI CTNAG 5 cut(s) 93, 198, 304, 495, 534
BstDSI CCRYGG 2 cut(s) 240, 288
BstF5I GGATG 1 cut(s) 484
BstKTI GATC 3 cut(s) 382, 631, 671
BstMAI GTCTC 4 cut(s) 74, 443, 476, 583
BstMBI GATC 3 cut(s) 379, 628, 668
BstNI CCWGG 3 cut(s) 24, 233, 439
BstNSI RCATGY 2 cut(s) 378, 653
BstSCI CCNGG 3 cut(s) 22, 231, 437
BstSFI CTRYAG 1 cut(s) 468
BstV2I GAAGAC 1 cut(s) 104
BstXI CCANNNNNNTGG 1 cut(s) 398
Bsu36I CCTNAGG 1 cut(s) 534
BsuRI GGCC 1 cut(s) 390
BtgI CCRYGG 2 cut(s) 240, 288
BtsCI GGATG 1 cut(s) 484
Csp6I GTAC 1 cut(s) 27
CviAII CATG 4 cut(s) 241, 289, 375, 650
CviJI RGCY 4 cut(s) 125, 162, 365, 390
CviKI_1 RGCY 4 cut(s) 125, 162, 365, 390
CviQI GTAC 1 cut(s) 27
DdeI CTNAG 5 cut(s) 93, 198, 304, 495, 534
DpnI GATC 3 cut(s) 381, 630, 670
DpnII GATC 3 cut(s) 379, 628, 668
DriI GACNNNNNGTC 1 cut(s) 433
EaeI YGGCCR 1 cut(s) 388
Eam1104I CTCTTC 1 cut(s) 180
Eam1105I GACNNNNNGTC 1 cut(s) 433
EarI CTCTTC 1 cut(s) 180
Eco130I CCWWGG 2 cut(s) 240, 288
Eco31I GGTCTC 1 cut(s) 74
Eco57I CTGAAG 2 cut(s) 147, 366
Eco81I CCTNAGG 1 cut(s) 534
EcoRII CCWGG 3 cut(s) 22, 231, 437
EcoT14I CCWWGG 2 cut(s) 240, 288
ErhI CCWWGG 2 cut(s) 240, 288
Esp3I CGTCTC 1 cut(s) 583
FaeI CATG 4 cut(s) 244, 292, 378, 653
FaiI YATR 9 cut(s) 122, 183, 242, 272, 290, 376, 414, 426, 651
FatI CATG 4 cut(s) 240, 288, 374, 649
FbaI TGATCA 1 cut(s) 628
FokI GGATG 1 cut(s) 491
FspBI CTAG 2 cut(s) 585, 715
HaeIII GGCC 1 cut(s) 390
Hin1II CATG 4 cut(s) 244, 292, 378, 653
HinfI GANTC 2 cut(s) 89, 428
HphI GGTGA 3 cut(s) 28, 220, 341
Hpy166II GTNNAC 2 cut(s) 19, 521
Hpy188I TCNGA 2 cut(s) 307, 422
Hpy188III TCNNGA 8 cut(s) 56, 497, 509, 536, 548, 607, 672, 704
Hpy8I GTNNAC 2 cut(s) 19, 521
HpyCH4III ACNGT 2 cut(s) 47, 682
HpyCH4V TGCA 2 cut(s) 686, 698
HpyF3I CTNAG 5 cut(s) 93, 198, 304, 495, 534
Hsp92II CATG 4 cut(s) 244, 292, 378, 653
Ksp22I TGATCA 1 cut(s) 628
Kzo9I GATC 3 cut(s) 379, 628, 668
MaeI CTAG 2 cut(s) 585, 715
MaeIII GTNAC 2 cut(s) 38, 53
MalI GATC 3 cut(s) 381, 630, 670
MboI GATC 3 cut(s) 379, 628, 668
MboII GAAGA 8 cut(s) 109, 147, 197, 291, 329, 344, 359, 524
MlsI TGGCCA 1 cut(s) 390
MluCI AATT 2 cut(s) 462, 699
MluNI TGGCCA 1 cut(s) 390
MlyI GAGTC 2 cut(s) 98, 422
MnlI CCTC 3 cut(s) 313, 543, 550
Mox20I TGGCCA 1 cut(s) 390
MroXI GAANNNNTTC 3 cut(s) 462, 504, 543
MscI TGGCCA 1 cut(s) 390
MslI CAYNNNNRTG 1 cut(s) 648
Msp20I TGGCCA 1 cut(s) 390
MspR9I CCNGG 3 cut(s) 24, 233, 439
Mva1269I GAATGC 1 cut(s) 119
MvaI CCWGG 3 cut(s) 24, 233, 439
NcoI CCATGG 2 cut(s) 240, 288
NdeII GATC 3 cut(s) 379, 628, 668
NlaIII CATG 4 cut(s) 244, 292, 378, 653
NmuCI GTSAC 2 cut(s) 38, 53
NspI RCATGY 2 cut(s) 378, 653
PciI ACATGT 1 cut(s) 374
PctI GAATGC 1 cut(s) 119
PdmI GAANNNNTTC 3 cut(s) 462, 504, 543
PfoI TCCNGGA 1 cut(s) 231
PleI GAGTC 2 cut(s) 97, 422
PpsI GAGTC 2 cut(s) 97, 422
PscI ACATGT 1 cut(s) 374
PsiI TTATAA 1 cut(s) 414
Psp6I CCWGG 3 cut(s) 22, 231, 437
PspGI CCWGG 3 cut(s) 22, 231, 437
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
RseI CAYNNNNRTG 1 cut(s) 648
Sau3AI GATC 3 cut(s) 379, 628, 668
SchI GAGTC 2 cut(s) 98, 422
ScrFI CCNGG 3 cut(s) 24, 233, 439
SetI ASST 6 cut(s) 18, 104, 127, 210, 367, 561
SfcI CTRYAG 1 cut(s) 468
SmiMI CAYNNNNRTG 1 cut(s) 648
SpeI ACTAGT 1 cut(s) 584
Sse9I AATT 2 cut(s) 462, 699
SspI AATATT 1 cut(s) 505
SspMI CTAG 2 cut(s) 585, 715
StyD4I CCNGG 3 cut(s) 22, 231, 437
StyI CCWWGG 2 cut(s) 240, 288
TaaI ACNGT 2 cut(s) 47, 682
TaqI TCGA 2 cut(s) 569, 606
TasI AATT 2 cut(s) 462, 699
TseFI GTSAC 2 cut(s) 38, 53
Tsp45I GTSAC 2 cut(s) 38, 53
TspDTI ATGAA 3 cut(s) 109, 198, 517
TspGWI ACGGA 2 cut(s) 383, 423
XceI RCATGY 2 cut(s) 378, 653
XmnI GAANNNNTTC 3 cut(s) 462, 504, 543
XspI CTAG 2 cut(s) 585, 715
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.