Rmu_sc0004791.1_g000001
MYB Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004791.1
OG0000883
Physical Location & Seq
Reverse (-)
1676 .. 3370
1695 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004791.1_g000001.1.cds

Sequence Viewer

Length: 720 bp
atggctatagatcctatagaagaagcattcgataatcagccggtagctgcagttgagaacttggaagatgatgactatgttaatataattgagacctcaaatgagtggacgatctctttattggaactctaccatgatcctaagtggcgtgtggatactggcttcaaaaatggttacttgcagaaattacaagatatgatagaagccaaacttccaaactgtgggatactggcaaatccacacattgaatcaagaataaagacattgaaagggaaatatgttgcattaagcgaagcattatctcagagtggttttggatggaatgaagaagcaatgatgttggattgtgaaagaagtgtattcgatgagtgggcaaagaacaaaaaggatgcaaaaggtttgtatggtaaaccatttgaacattattatgcccttggagagatatatggaaaagatcgtgcaatgggaacaaatgctggaaatgctgaagatgatgaagaagaagttagggaagaggatgcaagcatgaatcaagagggtgtacgagctgatgacttttttgaacaaatgaacatgactactgatagtggatctcagtataggggatcacaatttgaggggcttggtgaaacggaagatgatgatatatcttttatacaaccaagtcccccccaaccaccaagtgccaagcaacgtgccaaacagcagagatcaacttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

239

Amino Acids

27.06

Weight (kDa)

4.39

Isoelectric Point (pI)

54.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 221
AclWI GGATC 4 cut(s) 5, 131, 598, 613
AcuI CTGAAG 1 cut(s) 507
AdeI CACNNNGTG 1 cut(s) 683
AfaI GTAC 1 cut(s) 543
AfiI CCNNNNNNNGG 1 cut(s) 221
AgsI TTSAA 5 cut(s) 166, 248, 268, 419, 563
AluBI AGCT 2 cut(s) 47, 548
AluI AGCT 2 cut(s) 47, 548
Alw26I GTCTC 1 cut(s) 86
AlwI GGATC 4 cut(s) 5, 131, 598, 613
ApeKI GCWGC 1 cut(s) 47
AsuHPI GGTGA 1 cut(s) 638
BbvI GCAGC 1 cut(s) 34
BccI CCATC 1 cut(s) 312
BciVI GTATCC 2 cut(s) 148, 219
BcoDI GTCTC 1 cut(s) 86
BfmI CTRYAG 3 cut(s) 6, 15, 48
BfuI GTATCC 2 cut(s) 148, 219
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
BmsI GCATC 2 cut(s) 379, 508
BsaI GGTCTC 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 433
Bsc4I CCNNNNNNNGG 1 cut(s) 221
Bse118I RCCGGY 1 cut(s) 40
Bse1I ACTGG 2 cut(s) 163, 234
Bse3DI GCAATG 2 cut(s) 339, 468
BseDI CCNNGG 1 cut(s) 433
BseGI GGATG 3 cut(s) 323, 394, 523
BseLI CCNNNNNNNGG 1 cut(s) 221
BseMI GCAATG 2 cut(s) 339, 468
BseMII CTCAG 2 cut(s) 317, 608
BseNI ACTGG 2 cut(s) 163, 234
BseXI GCAGC 1 cut(s) 34
BsiSI CCGG 1 cut(s) 41
BslFI GGGAC 1 cut(s) 651
BslI CCNNNNNNNGG 1 cut(s) 221
BsmAI GTCTC 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 651
BsmI GAATGC 1 cut(s) 26
Bso31I GGTCTC 1 cut(s) 86
Bsp143I GATC 7 cut(s) 10, 111, 136, 454, 590, 605, 710
BspCNI CTCAG 2 cut(s) 316, 607
BspMAI CTGCAG 1 cut(s) 52
BspPI GGATC 4 cut(s) 5, 131, 598, 613
BspTNI GGTCTC 1 cut(s) 86
BsrDI GCAATG 2 cut(s) 339, 468
BsrFI RCCGGY 1 cut(s) 40
BsrI ACTGG 2 cut(s) 163, 234
BssAI RCCGGY 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 433
BssMI GATC 7 cut(s) 10, 111, 136, 454, 590, 605, 710
BssT1I CCWWGG 1 cut(s) 433
Bst4CI ACNGT 1 cut(s) 221
Bst6I CTCTTC 1 cut(s) 507
BstC8I GCNNGC 1 cut(s) 523
BstDEI CTNAG 3 cut(s) 141, 303, 594
BstF5I GGATG 3 cut(s) 323, 394, 523
BstKTI GATC 7 cut(s) 13, 114, 139, 457, 593, 608, 713
BstMAI GTCTC 1 cut(s) 86
BstMBI GATC 7 cut(s) 10, 111, 136, 454, 590, 605, 710
BstMWI GCNNNNNNNGC 1 cut(s) 482
BstSFI CTRYAG 3 cut(s) 6, 15, 48
BstV1I GCAGC 1 cut(s) 34
BstX2I RGATCY 2 cut(s) 10, 590
BstYI RGATCY 2 cut(s) 10, 590
BsuI GTATCC 2 cut(s) 148, 219
BtsCI GGATG 3 cut(s) 323, 394, 523
Cac8I GCNNGC 1 cut(s) 523
Cfr10I RCCGGY 1 cut(s) 40
Csp6I GTAC 1 cut(s) 542
CviAII CATG 3 cut(s) 134, 526, 574
CviJI RGCY 7 cut(s) 5, 40, 47, 162, 206, 548, 622
CviKI_1 RGCY 7 cut(s) 5, 40, 47, 162, 206, 548, 622
CviQI GTAC 1 cut(s) 542
DdeI CTNAG 3 cut(s) 141, 303, 594
DpnI GATC 7 cut(s) 12, 113, 138, 456, 592, 607, 712
DpnII GATC 7 cut(s) 10, 111, 136, 454, 590, 605, 710
DraIII CACNNNGTG 1 cut(s) 683
Eam1104I CTCTTC 1 cut(s) 507
EarI CTCTTC 1 cut(s) 507
Eco130I CCWWGG 1 cut(s) 433
Eco31I GGTCTC 1 cut(s) 86
Eco57I CTGAAG 1 cut(s) 507
EcoT14I CCWWGG 1 cut(s) 433
ErhI CCWWGG 1 cut(s) 433
FaeI CATG 3 cut(s) 137, 529, 577
FalI AAGNNNNNCTT 2 cut(s) 195, 227
FaqI GGGAC 1 cut(s) 651
FatI CATG 3 cut(s) 133, 525, 573
Fnu4HI GCNGC 1 cut(s) 48
FokI GGATG 3 cut(s) 330, 401, 530
Fsp4HI GCNGC 1 cut(s) 48
GluI GCNGC 1 cut(s) 48
HapII CCGG 1 cut(s) 41
Hin1II CATG 3 cut(s) 137, 529, 577
HinfI GANTC 2 cut(s) 248, 529
HpaII CCGG 1 cut(s) 41
HphI GGTGA 1 cut(s) 638
Hpy166II GTNNAC 3 cut(s) 108, 410, 542
Hpy188I TCNGA 1 cut(s) 306
Hpy188III TCNNGA 2 cut(s) 252, 533
Hpy8I GTNNAC 3 cut(s) 108, 410, 542
HpyCH4III ACNGT 1 cut(s) 221
HpyCH4IV ACGT 1 cut(s) 694
HpyCH4V TGCA 6 cut(s) 50, 181, 284, 392, 461, 521
HpyF10VI GCNNNNNNNGC 1 cut(s) 482
HpyF3I CTNAG 3 cut(s) 141, 303, 594
HpySE526I ACGT 1 cut(s) 694
Hsp92II CATG 3 cut(s) 137, 529, 577
Kzo9I GATC 7 cut(s) 10, 111, 136, 454, 590, 605, 710
LpnPI CCDG 4 cut(s) 54, 144, 215, 462
Lsp1109I GCAGC 1 cut(s) 34
LweI GCATC 2 cut(s) 379, 508
MaeII ACGT 1 cut(s) 694
MaeIII GTNAC 1 cut(s) 173
MalI GATC 7 cut(s) 12, 113, 138, 456, 592, 607, 712
MboI GATC 7 cut(s) 10, 111, 136, 454, 590, 605, 710
MboII GAAGA 8 cut(s) 32, 77, 338, 500, 509, 512, 524, 647
MflI RGATCY 2 cut(s) 10, 590
MluCI AATT 3 cut(s) 87, 185, 611
MmeI TCCRAC 1 cut(s) 321
MnlI CCTC 4 cut(s) 106, 508, 529, 610
MseI TTAA 3 cut(s) 81, 287, 718
MslI CAYNNNNRTG 1 cut(s) 426
MspI CCGG 1 cut(s) 41
Mva1269I GAATGC 1 cut(s) 26
MwoI GCNNNNNNNGC 1 cut(s) 482
NdeII GATC 7 cut(s) 10, 111, 136, 454, 590, 605, 710
NlaIII CATG 3 cut(s) 137, 529, 577
PctI GAATGC 1 cut(s) 26
PfeI GAWTC 2 cut(s) 248, 529
PflMI CCANNNNNTGG 1 cut(s) 221
PkrI GCNGC 1 cut(s) 49
PstI CTGCAG 1 cut(s) 52
PsuI RGATCY 2 cut(s) 10, 590
RsaI GTAC 1 cut(s) 543
RsaNI GTAC 1 cut(s) 542
RseI CAYNNNNRTG 1 cut(s) 426
SaqAI TTAA 3 cut(s) 81, 287, 718
SatI GCNGC 1 cut(s) 48
Sau3AI GATC 7 cut(s) 10, 111, 136, 454, 590, 605, 710
SetI ASST 5 cut(s) 49, 98, 400, 550, 697
SfaNI GCATC 2 cut(s) 379, 508
SfcI CTRYAG 3 cut(s) 6, 15, 48
SmiMI CAYNNNNRTG 1 cut(s) 426
Sse9I AATT 3 cut(s) 87, 185, 611
StyI CCWWGG 1 cut(s) 433
TaaI ACNGT 1 cut(s) 221
TaiI ACGT 1 cut(s) 697
TaqI TCGA 2 cut(s) 30, 363
TasI AATT 3 cut(s) 87, 185, 611
TfiI GAWTC 2 cut(s) 248, 529
Tru1I TTAA 3 cut(s) 81, 287, 718
Tru9I TTAA 3 cut(s) 81, 287, 718
TseI GCWGC 1 cut(s) 47
TspDTI ATGAA 4 cut(s) 339, 510, 542, 584
TspGWI ACGGA 1 cut(s) 647
Van91I CCANNNNNTGG 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.