Rmu_sc0006115.1_g000003
MYB Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006115.1
OG0000883
Physical Location & Seq
Forward (+)
20364 .. 21496
1133 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006115.1_g000003.1.cds

Sequence Viewer

Length: 846 bp
atgagttccggagctacttcaagcaaatcaaaaaaagttggaaggggccaaaacaagcgtttctggacaaccaaggaagatgatgtattggtcagctctttattggaactctaccatgatcctaagtggcgtgtggatactggcttcaaaaatggttacttgcagaaattacaagatatgatagaagccaaacttccaaactgtgggatactggcaaatccacacattgaatcaagaataaagacattgaaagggaaatatgttgcattaagcgaagcattatctcagagtggttttggatggaatgaagaagcaatgatgttggattgtgaaagaagtgtattcgatgagtgggcaaagaacaaaaaggatgcaaaaggtttgtatggtaaaccatttgaacattattatgcccttggagagatatatggaaaagatcgtgcaatgggaacaaatgctggaaatgctgaagatgatgaagaagaagttagggaagaggatgcaagcatgaatcaagagggtgtacgagctgatgacttttttgaacaaatgaacatgactactgatagtggatctcagtataggggatcacaatttgaggggcttggaatggctccaaagtttgaaggcttgattaatgttctctcaacagataaggatcttgctgatatgcaaggcaaatttggtggtgagctgaggaaaatggatatcctatctccattgcaggtatttcacgtcaccaacaaattagctaaagagcatgacttgttgagggtcttcttcaccatgactgatgaggaaaagaaggattacataatcaaccttctgcaatatggcctacagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

281

Amino Acids

31.87

Weight (kDa)

5.16

Isoelectric Point (pI)

41.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 715
AccB7I CCANNNNNTGG 1 cut(s) 203
AccIII TCCGGA 1 cut(s) 8
AclWI GGATC 4 cut(s) 113, 580, 595, 666
AcsI RAATTY 1 cut(s) 680
AcuI CTGAAG 1 cut(s) 489
AfaI GTAC 1 cut(s) 525
AfiI CCNNNNNNNGG 1 cut(s) 203
AgsI TTSAA 7 cut(s) 21, 148, 230, 250, 401, 545, 626
AjiI CACGTC 1 cut(s) 736
AluBI AGCT 5 cut(s) 14, 96, 530, 694, 752
AluI AGCT 5 cut(s) 14, 96, 530, 694, 752
AlwI GGATC 4 cut(s) 113, 580, 595, 666
Aor13HI TCCGGA 1 cut(s) 8
AoxI GGCC 2 cut(s) 46, 835
ApoI RAATTY 1 cut(s) 680
AseI ATTAAT 1 cut(s) 636
AspS9I GGNCC 1 cut(s) 46
AsuHPI GGTGA 3 cut(s) 701, 730, 775
BbsI GAAGAC 1 cut(s) 769
BbvCI CCTCAGC 1 cut(s) 695
BccI CCATC 1 cut(s) 294
BciVI GTATCC 2 cut(s) 130, 201
BfmI CTRYAG 1 cut(s) 839
BfuAI ACCTGC 1 cut(s) 715
BfuI GTATCC 2 cut(s) 130, 201
BmgBI CACGTC 1 cut(s) 736
BmgT120I GGNCC 1 cut(s) 46
BmiI GGNNCC 2 cut(s) 47, 615
BmsI GCATC 2 cut(s) 361, 490
BpiI GAAGAC 1 cut(s) 769
Bpu10I CCTNAGC 1 cut(s) 695
BsaBI GATNNNNATC 1 cut(s) 657
BsaJI CCNNGG 2 cut(s) 72, 415
BsaWI WCCGGW 1 cut(s) 8
Bsc4I CCNNNNNNNGG 1 cut(s) 203
Bse1I ACTGG 2 cut(s) 145, 216
Bse3DI GCAATG 3 cut(s) 321, 450, 719
Bse8I GATNNNNATC 1 cut(s) 657
BseAI TCCGGA 1 cut(s) 8
BseDI CCNNGG 2 cut(s) 72, 415
BseGI GGATG 3 cut(s) 305, 376, 505
BseJI GATNNNNATC 1 cut(s) 657
BseLI CCNNNNNNNGG 1 cut(s) 203
BseMI GCAATG 3 cut(s) 321, 450, 719
BseMII CTCAG 3 cut(s) 299, 590, 686
BseNI ACTGG 2 cut(s) 145, 216
BshFI GGCC 2 cut(s) 48, 837
BsiSI CCGG 1 cut(s) 9
BslI CCNNNNNNNGG 1 cut(s) 203
BsnI GGCC 2 cut(s) 48, 837
Bsp13I TCCGGA 1 cut(s) 8
Bsp143I GATC 5 cut(s) 118, 436, 572, 587, 658
BspANI GGCC 2 cut(s) 48, 837
BspCNI CTCAG 3 cut(s) 298, 589, 687
BspEI TCCGGA 1 cut(s) 8
BspLI GGNNCC 2 cut(s) 47, 615
BspMI ACCTGC 1 cut(s) 715
BspPI GGATC 4 cut(s) 113, 580, 595, 666
BsrDI GCAATG 3 cut(s) 321, 450, 719
BsrI ACTGG 2 cut(s) 145, 216
BssECI CCNNGG 2 cut(s) 72, 415
BssMI GATC 5 cut(s) 118, 436, 572, 587, 658
BssT1I CCWWGG 2 cut(s) 72, 415
Bst4CI ACNGT 2 cut(s) 203, 843
Bst6I CTCTTC 1 cut(s) 489
BstC8I GCNNGC 1 cut(s) 505
BstDEI CTNAG 4 cut(s) 123, 285, 576, 695
BstF5I GGATG 3 cut(s) 305, 376, 505
BstKTI GATC 5 cut(s) 121, 439, 575, 590, 661
BstMBI GATC 5 cut(s) 118, 436, 572, 587, 658
BstMWI GCNNNNNNNGC 1 cut(s) 464
BstSFI CTRYAG 1 cut(s) 839
BstV2I GAAGAC 1 cut(s) 769
BstX2I RGATCY 2 cut(s) 572, 658
BstYI RGATCY 2 cut(s) 572, 658
BsuI GTATCC 2 cut(s) 130, 201
BsuRI GGCC 2 cut(s) 48, 837
BtrI CACGTC 1 cut(s) 736
BtsCI GGATG 3 cut(s) 305, 376, 505
BveI ACCTGC 1 cut(s) 715
Cac8I GCNNGC 1 cut(s) 505
Cfr13I GGNCC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 524
CspCI CAANNNNNGTGG 2 cut(s) 667, 702
CviAII CATG 5 cut(s) 116, 508, 556, 761, 787
CviQI GTAC 1 cut(s) 524
DdeI CTNAG 4 cut(s) 123, 285, 576, 695
DpnI GATC 5 cut(s) 120, 438, 574, 589, 660
DpnII GATC 5 cut(s) 118, 436, 572, 587, 658
Eam1104I CTCTTC 1 cut(s) 489
EarI CTCTTC 1 cut(s) 489
Eco130I CCWWGG 2 cut(s) 72, 415
Eco32I GATATC 1 cut(s) 709
Eco57I CTGAAG 1 cut(s) 489
EcoRV GATATC 1 cut(s) 709
EcoT14I CCWWGG 2 cut(s) 72, 415
ErhI CCWWGG 2 cut(s) 72, 415
FaeI CATG 5 cut(s) 119, 511, 559, 764, 790
FalI AAGNNNNNCTT 2 cut(s) 177, 209
FatI CATG 5 cut(s) 115, 507, 555, 760, 786
FokI GGATG 3 cut(s) 312, 383, 512
HaeIII GGCC 2 cut(s) 48, 837
HapII CCGG 1 cut(s) 9
Hin1II CATG 5 cut(s) 119, 511, 559, 764, 790
HinfI GANTC 2 cut(s) 230, 511
HpaII CCGG 1 cut(s) 9
HphI GGTGA 3 cut(s) 701, 730, 775
Hpy166II GTNNAC 2 cut(s) 392, 524
Hpy188I TCNGA 1 cut(s) 288
Hpy188III TCNNGA 4 cut(s) 9, 64, 234, 515
Hpy8I GTNNAC 2 cut(s) 392, 524
HpyAV CCTTC 4 cut(s) 36, 620, 799, 833
HpyCH4III ACNGT 2 cut(s) 203, 843
HpyCH4IV ACGT 1 cut(s) 735
HpyCH4V TGCA 8 cut(s) 163, 266, 374, 443, 503, 673, 724, 829
HpyF10VI GCNNNNNNNGC 1 cut(s) 464
HpyF3I CTNAG 4 cut(s) 123, 285, 576, 695
HpySE526I ACGT 1 cut(s) 735
Hsp92II CATG 5 cut(s) 119, 511, 559, 764, 790
Kpn2I TCCGGA 1 cut(s) 8
Kzo9I GATC 5 cut(s) 118, 436, 572, 587, 658
LmnI GCTCC 2 cut(s) 11, 619
LpnPI CCDG 6 cut(s) 22, 49, 126, 197, 444, 710
LweI GCATC 2 cut(s) 361, 490
MaeII ACGT 1 cut(s) 735
MaeIII GTNAC 2 cut(s) 155, 736
MalI GATC 5 cut(s) 120, 438, 574, 589, 660
MboI GATC 5 cut(s) 118, 436, 572, 587, 658
MboII GAAGA 8 cut(s) 89, 320, 482, 491, 494, 506, 769, 772
MflI RGATCY 2 cut(s) 572, 658
MluCI AATT 4 cut(s) 167, 593, 680, 746
MmeI TCCRAC 2 cut(s) 19, 303
MnlI CCTC 6 cut(s) 490, 511, 592, 690, 765, 790
MroI TCCGGA 1 cut(s) 8
MseI TTAA 2 cut(s) 269, 636
MslI CAYNNNNRTG 1 cut(s) 408
MspI CCGG 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 464
NdeII GATC 5 cut(s) 118, 436, 572, 587, 658
NlaIII CATG 5 cut(s) 119, 511, 559, 764, 790
NlaIV GGNNCC 2 cut(s) 47, 615
NmuCI GTSAC 1 cut(s) 736
PfeI GAWTC 2 cut(s) 230, 511
PflMI CCANNNNNTGG 1 cut(s) 203
PshBI ATTAAT 1 cut(s) 636
PspN4I GGNNCC 2 cut(s) 47, 615
PspPI GGNCC 1 cut(s) 46
PsuI RGATCY 2 cut(s) 572, 658
RsaI GTAC 1 cut(s) 525
RsaNI GTAC 1 cut(s) 524
RseI CAYNNNNRTG 1 cut(s) 408
SaqAI TTAA 2 cut(s) 269, 636
Sau3AI GATC 5 cut(s) 118, 436, 572, 587, 658
Sau96I GGNCC 1 cut(s) 46
SetI ASST 9 cut(s) 16, 98, 382, 532, 696, 729, 738, 754, 825
SfaNI GCATC 2 cut(s) 361, 490
SfcI CTRYAG 1 cut(s) 839
SmiMI CAYNNNNRTG 1 cut(s) 408
Sse9I AATT 4 cut(s) 167, 593, 680, 746
StyI CCWWGG 2 cut(s) 72, 415
TaaI ACNGT 2 cut(s) 203, 843
TaiI ACGT 1 cut(s) 738
TaqI TCGA 1 cut(s) 345
TasI AATT 4 cut(s) 167, 593, 680, 746
TfiI GAWTC 2 cut(s) 230, 511
Tru1I TTAA 2 cut(s) 269, 636
Tru9I TTAA 2 cut(s) 269, 636
TseFI GTSAC 1 cut(s) 736
Tsp45I GTSAC 1 cut(s) 736
TspDTI ATGAA 4 cut(s) 321, 492, 524, 566
Van91I CCANNNNNTGG 1 cut(s) 203
VspI ATTAAT 1 cut(s) 636
XapI RAATTY 1 cut(s) 680
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.