Rh3DG355100
MYB Family

DDE superfamily endonuclease

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
43115364 .. 43115957
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG355100.1

Sequence Viewer

Length: 300 bp
ATGGAAACAAATGTTGGAAATGCTAAAGATGATGAAGAAGAAGTTAGGGAAAGGGATGCAAGTATGAATCAAGAGGGTGTACAAGTTGATGACGTTTTTGAACAAATGAATATGACTAGTGATGGTGGATCTCAGTATAGGGGATCACAATTTGAGGGGCATGATGAGACGGAAGATGAAGATGTATTTCACATCACTAACAAACTAGCTAAAGAGCATGGCTTGTTGAGGGTCTTCTTTACCATGATTGATGAGGAAAAGAAAGATTACATAATCCACCTTTTGCCACATGGCCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.42

Weight (kDa)

4.39

Isoelectric Point (pI)

30.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 136, 151
AfaI GTAC 1 cut(s) 81
AgsI TTSAA 1 cut(s) 101
AhlI ACTAGT 1 cut(s) 116
AjuI GAANNNNNNNTTGG 1 cut(s) 29
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
Alw26I GTCTC 1 cut(s) 161
AlwI GGATC 2 cut(s) 136, 151
AoxI GGCC 1 cut(s) 292
BbsI GAAGAC 1 cut(s) 226
BccI CCATC 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 161
BcuI ACTAGT 1 cut(s) 116
BfaI CTAG 2 cut(s) 117, 206
BfmI CTRYAG 1 cut(s) 296
BmsI GCATC 1 cut(s) 46
BpiI GAAGAC 1 cut(s) 226
BseGI GGATG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 146
BshFI GGCC 1 cut(s) 294
BsmAI GTCTC 1 cut(s) 161
BsmBI CGTCTC 1 cut(s) 161
BsnI GGCC 1 cut(s) 294
Bsp1407I TGTACA 1 cut(s) 79
Bsp143I GATC 2 cut(s) 128, 143
BspANI GGCC 1 cut(s) 294
BspCNI CTCAG 1 cut(s) 145
BspPI GGATC 2 cut(s) 136, 151
BsrGI TGTACA 1 cut(s) 79
BssMI GATC 2 cut(s) 128, 143
BstAUI TGTACA 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 132
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 2 cut(s) 131, 146
BstMAI GTCTC 1 cut(s) 161
BstMBI GATC 2 cut(s) 128, 143
BstSFI CTRYAG 1 cut(s) 296
BstV2I GAAGAC 1 cut(s) 226
BstX2I RGATCY 1 cut(s) 128
BstYI RGATCY 1 cut(s) 128
BsuRI GGCC 1 cut(s) 294
BtsCI GGATG 1 cut(s) 61
Csp6I GTAC 1 cut(s) 80
CviAII CATG 4 cut(s) 161, 218, 244, 290
CviJI RGCY 3 cut(s) 209, 222, 294
CviKI_1 RGCY 3 cut(s) 209, 222, 294
CviQI GTAC 1 cut(s) 80
DdeI CTNAG 1 cut(s) 132
DpnI GATC 2 cut(s) 130, 145
DpnII GATC 2 cut(s) 128, 143
Esp3I CGTCTC 1 cut(s) 161
FaeI CATG 4 cut(s) 164, 221, 247, 293
FaiI YATR 9 cut(s) 65, 113, 138, 162, 219, 245, 272, 291, 298
FatI CATG 4 cut(s) 160, 217, 243, 289
FokI GGATG 1 cut(s) 68
FspBI CTAG 2 cut(s) 117, 206
HaeIII GGCC 1 cut(s) 294
Hin1II CATG 4 cut(s) 164, 221, 247, 293
HinfI GANTC 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 80
Hpy188III TCNNGA 1 cut(s) 71
Hpy8I GTNNAC 1 cut(s) 80
HpyCH4IV ACGT 1 cut(s) 93
HpyCH4V TGCA 1 cut(s) 59
HpyF3I CTNAG 1 cut(s) 132
HpySE526I ACGT 1 cut(s) 93
Hsp92II CATG 4 cut(s) 164, 221, 247, 293
Kzo9I GATC 2 cut(s) 128, 143
LweI GCATC 1 cut(s) 46
MaeI CTAG 2 cut(s) 117, 206
MaeII ACGT 1 cut(s) 93
MalI GATC 2 cut(s) 130, 145
MboI GATC 2 cut(s) 128, 143
MboII GAAGA 5 cut(s) 47, 50, 185, 191, 226
MflI RGATCY 1 cut(s) 128
MluCI AATT 1 cut(s) 149
MnlI CCTC 4 cut(s) 67, 148, 222, 247
NdeII GATC 2 cut(s) 128, 143
NlaIII CATG 4 cut(s) 164, 221, 247, 293
PfeI GAWTC 1 cut(s) 67
PsuI RGATCY 1 cut(s) 128
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
Sau3AI GATC 2 cut(s) 128, 143
SetI ASST 3 cut(s) 96, 211, 282
SfaNI GCATC 1 cut(s) 46
SfcI CTRYAG 1 cut(s) 296
SgeI CNNG 9 cut(s) 72, 83, 95, 129, 173, 218, 230, 235, 256
SpeI ACTAGT 1 cut(s) 116
Sse9I AATT 1 cut(s) 149
SspMI CTAG 2 cut(s) 117, 206
TaiI ACGT 1 cut(s) 96
TasI AATT 1 cut(s) 149
TatI WGTACW 1 cut(s) 79
TfiI GAWTC 1 cut(s) 67
TspDTI ATGAA 4 cut(s) 48, 80, 122, 192
TspGWI ACGGA 1 cut(s) 185
XspI CTAG 2 cut(s) 117, 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.