Rh7CG384200
MYB Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0000883
Physical Location & Seq
Reverse (-)
48494803 .. 48496153
1351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG384200.1

Sequence Viewer

Length: 738 bp
ATGATGTTGGATTGTGAAAGAAGTGTATTCGATGAGTGGGCAAAGAACAAAAAGGATGCAAAAGGTTTGTATGGTAAACCATTTGAACATTATTATGCCCTTGGAGAGATATATGGAAAAGATCGTGCAATGGGAACAAATGCTGGAAATGCTGAAGATGATGAAGAAGAAGTTAGGGAAGAGGATGCAAGCATGAATCAAGAGGGTGTACGACCTGATGACTTTTTTCAACAAATGAACATGACTACTGATGGTGGATCTCAGTATAGGGGATCACAATTTGAGGGGCTTGGTGAAACGGAAGATGATGATATATCTTTTATACAACCAAGTCCCCCCCAACCACCAAGTGCCAAGCAACGTGCCAAACAGCAGAGGTCAACTCAAGATGTAACAAATGCTCCAAATAATACTCGTAGAAAGGCAAGAGCTTTGGATGATATGGCTAAAAAATTTGGAGTGATCACTGAAGCCATTGCAGGAATGGCTCCAAAGTTTGAAGGCTTGATTAATGTTCTCTCAACAGATAAGGATCTTGCTGATATGCAAGGCAAACTTGGTGGTGAGCTGAGGAAAATGGATTTCCTATCTCCATTGCAGGTATTTCACGTCACCAACAAATTAGCTAAAGAGCATGACTTGTTGAGGGTCTTCTTCACCATGACTGATGAGGAAAAGAAGGATTACATAATCAACCTTCTGCAATATGGCCTACAGTTAATGGGTGCTTGGACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

245

Amino Acids

27.7

Weight (kDa)

4.83

Isoelectric Point (pI)

43.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 589
AclWI GGATC 3 cut(s) 265, 280, 540
AcsI RAATTY 1 cut(s) 452
AcuI CTGAAG 2 cut(s) 174, 489
AdeI CACNNNGTG 1 cut(s) 350
AfaI GTAC 1 cut(s) 210
AgsI TTSAA 3 cut(s) 86, 230, 500
AjiI CACGTC 1 cut(s) 610
AluBI AGCT 3 cut(s) 431, 568, 626
AluI AGCT 3 cut(s) 431, 568, 626
AlwI GGATC 3 cut(s) 265, 280, 540
AoxI GGCC 1 cut(s) 709
ApoI RAATTY 1 cut(s) 452
AseI ATTAAT 1 cut(s) 510
AsuHPI GGTGA 4 cut(s) 305, 575, 604, 649
BbsI GAAGAC 1 cut(s) 643
BbvCI CCTCAGC 1 cut(s) 569
BccI CCATC 1 cut(s) 245
BclI TGATCA 1 cut(s) 462
BfmI CTRYAG 1 cut(s) 713
BfuAI ACCTGC 1 cut(s) 589
BmgBI CACGTC 1 cut(s) 610
BmiI GGNNCC 1 cut(s) 489
BmsI GCATC 2 cut(s) 46, 175
BpiI GAAGAC 1 cut(s) 643
BplI GAGNNNNNCTC 2 cut(s) 367, 399
Bpu10I CCTNAGC 1 cut(s) 569
BpuEI CTTGAG 1 cut(s) 369
BsaBI GATNNNNATC 1 cut(s) 531
BsaJI CCNNGG 1 cut(s) 100
BsaXI ACNNNNNCTCC 2 cut(s) 385, 415
Bse3DI GCAATG 3 cut(s) 135, 474, 593
Bse8I GATNNNNATC 1 cut(s) 531
BseDI CCNNGG 1 cut(s) 100
BseGI GGATG 3 cut(s) 61, 190, 442
BseJI GATNNNNATC 1 cut(s) 531
BseMI GCAATG 3 cut(s) 135, 474, 593
BseMII CTCAG 2 cut(s) 275, 560
BshFI GGCC 1 cut(s) 711
BslFI GGGAC 1 cut(s) 318
BsmFI GGGAC 1 cut(s) 318
BsnI GGCC 1 cut(s) 711
Bsp143I GATC 5 cut(s) 121, 257, 272, 462, 532
BspANI GGCC 1 cut(s) 711
BspCNI CTCAG 2 cut(s) 274, 561
BspLI GGNNCC 1 cut(s) 489
BspMI ACCTGC 1 cut(s) 589
BspPI GGATC 3 cut(s) 265, 280, 540
BsrDI GCAATG 3 cut(s) 135, 474, 593
BssECI CCNNGG 1 cut(s) 100
BssMI GATC 5 cut(s) 121, 257, 272, 462, 532
BssT1I CCWWGG 1 cut(s) 100
Bst4CI ACNGT 1 cut(s) 717
Bst6I CTCTTC 1 cut(s) 174
BstC8I GCNNGC 1 cut(s) 190
BstDEI CTNAG 3 cut(s) 261, 569, 735
BstF5I GGATG 3 cut(s) 61, 190, 442
BstKTI GATC 5 cut(s) 124, 260, 275, 465, 535
BstMBI GATC 5 cut(s) 121, 257, 272, 462, 532
BstMWI GCNNNNNNNGC 2 cut(s) 149, 485
BstSFI CTRYAG 1 cut(s) 713
BstV2I GAAGAC 1 cut(s) 643
BstX2I RGATCY 2 cut(s) 257, 532
BstYI RGATCY 2 cut(s) 257, 532
BsuRI GGCC 1 cut(s) 711
BtrI CACGTC 1 cut(s) 610
BtsCI GGATG 3 cut(s) 61, 190, 442
BtsIMutI CAGTG 1 cut(s) 465
BveI ACCTGC 1 cut(s) 589
Cac8I GCNNGC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 209
CspCI CAANNNNNGTGG 2 cut(s) 541, 576
CviAII CATG 4 cut(s) 193, 241, 635, 661
CviJI RGCY 9 cut(s) 289, 431, 446, 473, 488, 504, 568, 626, 711
CviKI_1 RGCY 9 cut(s) 289, 431, 446, 473, 488, 504, 568, 626, 711
CviQI GTAC 1 cut(s) 209
DdeI CTNAG 3 cut(s) 261, 569, 735
DpnI GATC 5 cut(s) 123, 259, 274, 464, 534
DpnII GATC 5 cut(s) 121, 257, 272, 462, 532
DraIII CACNNNGTG 1 cut(s) 350
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
Eco130I CCWWGG 1 cut(s) 100
Eco57I CTGAAG 2 cut(s) 174, 489
EcoT14I CCWWGG 1 cut(s) 100
ErhI CCWWGG 1 cut(s) 100
FaeI CATG 4 cut(s) 196, 244, 638, 664
FalI AAGNNNNNCTT 2 cut(s) 540, 572
FaqI GGGAC 1 cut(s) 318
FatI CATG 4 cut(s) 192, 240, 634, 660
FbaI TGATCA 1 cut(s) 462
FokI GGATG 3 cut(s) 68, 197, 449
HaeIII GGCC 1 cut(s) 711
Hin1II CATG 4 cut(s) 196, 244, 638, 664
HincII GTYRAC 1 cut(s) 381
HindII GTYRAC 1 cut(s) 381
HinfI GANTC 1 cut(s) 196
HphI GGTGA 4 cut(s) 305, 575, 604, 649
Hpy166II GTNNAC 3 cut(s) 77, 209, 381
Hpy188III TCNNGA 2 cut(s) 200, 386
Hpy8I GTNNAC 3 cut(s) 77, 209, 381
HpyAV CCTTC 3 cut(s) 494, 673, 707
HpyCH4III ACNGT 1 cut(s) 717
HpyCH4IV ACGT 2 cut(s) 361, 609
HpyCH4V TGCA 7 cut(s) 59, 128, 188, 479, 547, 598, 703
HpyF10VI GCNNNNNNNGC 2 cut(s) 149, 485
HpyF3I CTNAG 3 cut(s) 261, 569, 735
HpySE526I ACGT 2 cut(s) 361, 609
Hsp92II CATG 4 cut(s) 196, 244, 638, 664
Ksp22I TGATCA 1 cut(s) 462
Kzo9I GATC 5 cut(s) 121, 257, 272, 462, 532
LmnI GCTCC 2 cut(s) 406, 493
LpnPI CCDG 4 cut(s) 129, 228, 465, 584
LweI GCATC 2 cut(s) 46, 175
MaeII ACGT 2 cut(s) 361, 609
MaeIII GTNAC 2 cut(s) 391, 610
MalI GATC 5 cut(s) 123, 259, 274, 464, 534
MboI GATC 5 cut(s) 121, 257, 272, 462, 532
MboII GAAGA 7 cut(s) 167, 176, 179, 191, 314, 643, 646
MflI RGATCY 2 cut(s) 257, 532
MluCI AATT 3 cut(s) 278, 452, 620
MnlI CCTC 7 cut(s) 175, 196, 277, 369, 564, 639, 664
MseI TTAA 2 cut(s) 510, 719
MslI CAYNNNNRTG 1 cut(s) 93
MwoI GCNNNNNNNGC 2 cut(s) 149, 485
NdeII GATC 5 cut(s) 121, 257, 272, 462, 532
NlaIII CATG 4 cut(s) 196, 244, 638, 664
NlaIV GGNNCC 1 cut(s) 489
NmuCI GTSAC 1 cut(s) 610
PfeI GAWTC 1 cut(s) 196
PshBI ATTAAT 1 cut(s) 510
PspN4I GGNNCC 1 cut(s) 489
PsuI RGATCY 2 cut(s) 257, 532
RsaI GTAC 1 cut(s) 210
RsaNI GTAC 1 cut(s) 209
RseI CAYNNNNRTG 1 cut(s) 93
SaqAI TTAA 2 cut(s) 510, 719
Sau3AI GATC 5 cut(s) 121, 257, 272, 462, 532
SfaNI GCATC 2 cut(s) 46, 175
SfcI CTRYAG 1 cut(s) 713
SmiMI CAYNNNNRTG 1 cut(s) 93
SmlI CTYRAG 1 cut(s) 384
SmoI CTYRAG 1 cut(s) 384
Sse9I AATT 3 cut(s) 278, 452, 620
StyI CCWWGG 1 cut(s) 100
TaaI ACNGT 1 cut(s) 717
TaiI ACGT 2 cut(s) 364, 612
TaqI TCGA 1 cut(s) 30
TasI AATT 3 cut(s) 278, 452, 620
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 2 cut(s) 510, 719
Tru9I TTAA 2 cut(s) 510, 719
TscAI CASTG 1 cut(s) 472
TseFI GTSAC 1 cut(s) 610
Tsp45I GTSAC 1 cut(s) 610
TspDTI ATGAA 3 cut(s) 177, 209, 251
TspGWI ACGGA 1 cut(s) 314
TspRI CASTG 1 cut(s) 472
VspI ATTAAT 1 cut(s) 510
XapI RAATTY 1 cut(s) 452
XcmI CCANNNNNNNNNTGG 1 cut(s) 481
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.