Rh1DG102500
MYB Family

DDE superfamily endonuclease

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
19151863 .. 19157114
5252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG102500.1

Sequence Viewer

Length: 756 bp
ATGGACGTAACATCCAATCCGAGATGGCTTCCACTCGTACACATCGCATTTCATCATCAACTTCTGATACCATGGTATCAGAACAAAAAGGATGCAAAAGGTTTGTATGGTAAGCCATTTGAACATTATTATGCCCTTGGAGAGATATATGGAAAAGATCGTGCAATGGGAACAAATGCTGGAAATGCTGAAGATGATGAAGAAGAAGTTAGGGAAGAGGATGCAAGCATGAATCAAGAGGGTGTACGAGCTGATGACTTTTTTGAACAAATGAACATGACTACTGATGGTGGATCTCAGTATAGGGGATCACAATTTGAGGGGCTTGGTGAAACGGAAGATGATGATATATCTTTTATACAACCAAGTCCCCCCCAACCACCAAGTGCCAAGCAACGTGCCAAACAGCAGAGATCAACTCAAGATGTAACAAATGCTCCAAATAATACTCGTAGAAAGGCAAGAGCTTTGGATGATATGGCTAAAAAATTTGGAGTGATCACTGAAGCCATTGCAGGAATGGCTCCAAAGTTTGAAGGCTTGATTAATGTTCTCTCAACAGATAAGGATCTTGTTGATATGCAAGGCAAACTTGGTGGTGAGCTGAGGAAAATGGATTTCCTATCTCCATTGCAGGTATTTCACGTCACCAACAAATTAGCTAAAGAGCATGACTTGTTGAGGGTCTTCTTCACCATGACTGATGAGGAAAAGAAGGATTACATAATCAACCTTCTGCAATATGGCCTACAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

251

Amino Acids

28.49

Weight (kDa)

5.07

Isoelectric Point (pI)

45.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 625
AclWI GGATC 3 cut(s) 301, 316, 576
AcsI RAATTY 1 cut(s) 488
AcuI CTGAAG 2 cut(s) 210, 525
AdeI CACNNNGTG 1 cut(s) 386
AfaI GTAC 2 cut(s) 39, 246
AgsI TTSAA 3 cut(s) 122, 266, 536
AjiI CACGTC 1 cut(s) 646
AluBI AGCT 4 cut(s) 251, 467, 604, 662
AluI AGCT 4 cut(s) 251, 467, 604, 662
AlwI GGATC 3 cut(s) 301, 316, 576
AoxI GGCC 1 cut(s) 745
ApoI RAATTY 1 cut(s) 488
AseI ATTAAT 1 cut(s) 546
AsuHPI GGTGA 4 cut(s) 341, 611, 640, 685
BaeI ACNNNNGTAYC 4 cut(s) 59, 59, 92, 92
BbsI GAAGAC 1 cut(s) 679
BbvCI CCTCAGC 1 cut(s) 605
BccI CCATC 2 cut(s) 18, 281
BclI TGATCA 1 cut(s) 498
BfmI CTRYAG 1 cut(s) 749
BfuAI ACCTGC 1 cut(s) 625
BmgBI CACGTC 1 cut(s) 646
BmiI GGNNCC 1 cut(s) 525
BmsI GCATC 2 cut(s) 82, 211
BpiI GAAGAC 1 cut(s) 679
BplI GAGNNNNNCTC 2 cut(s) 403, 435
Bpu10I CCTNAGC 1 cut(s) 605
BpuEI CTTGAG 1 cut(s) 405
BsaBI GATNNNNATC 1 cut(s) 567
BsaJI CCNNGG 2 cut(s) 71, 136
BsaXI ACNNNNNCTCC 2 cut(s) 421, 451
Bse3DI GCAATG 3 cut(s) 171, 510, 629
Bse8I GATNNNNATC 1 cut(s) 567
BseDI CCNNGG 2 cut(s) 71, 136
BseGI GGATG 4 cut(s) 11, 97, 226, 478
BseJI GATNNNNATC 1 cut(s) 567
BseMI GCAATG 3 cut(s) 171, 510, 629
BseMII CTCAG 2 cut(s) 311, 596
BshFI GGCC 1 cut(s) 747
BslFI GGGAC 1 cut(s) 354
BsmFI GGGAC 1 cut(s) 354
BsnI GGCC 1 cut(s) 747
Bsp143I GATC 6 cut(s) 157, 293, 308, 413, 498, 568
Bsp19I CCATGG 1 cut(s) 71
BspANI GGCC 1 cut(s) 747
BspCNI CTCAG 2 cut(s) 310, 597
BspLI GGNNCC 1 cut(s) 525
BspMI ACCTGC 1 cut(s) 625
BspPI GGATC 3 cut(s) 301, 316, 576
BsrDI GCAATG 3 cut(s) 171, 510, 629
BssECI CCNNGG 2 cut(s) 71, 136
BssMI GATC 6 cut(s) 157, 293, 308, 413, 498, 568
BssT1I CCWWGG 2 cut(s) 71, 136
Bst4CI ACNGT 1 cut(s) 753
Bst6I CTCTTC 1 cut(s) 210
BstC8I GCNNGC 1 cut(s) 226
BstDEI CTNAG 2 cut(s) 297, 605
BstDSI CCRYGG 1 cut(s) 71
BstF5I GGATG 4 cut(s) 11, 97, 226, 478
BstKTI GATC 6 cut(s) 160, 296, 311, 416, 501, 571
BstMBI GATC 6 cut(s) 157, 293, 308, 413, 498, 568
BstMWI GCNNNNNNNGC 2 cut(s) 185, 521
BstSFI CTRYAG 1 cut(s) 749
BstV2I GAAGAC 1 cut(s) 679
BstX2I RGATCY 2 cut(s) 293, 568
BstYI RGATCY 2 cut(s) 293, 568
BsuRI GGCC 1 cut(s) 747
BtgI CCRYGG 1 cut(s) 71
BtgZI GCGATG 1 cut(s) 28
BtrI CACGTC 1 cut(s) 646
BtsCI GGATG 4 cut(s) 11, 97, 226, 478
BtsIMutI CAGTG 1 cut(s) 501
BveI ACCTGC 1 cut(s) 625
Cac8I GCNNGC 1 cut(s) 226
Csp6I GTAC 2 cut(s) 38, 245
CspCI CAANNNNNGTGG 2 cut(s) 577, 612
CviAII CATG 5 cut(s) 72, 229, 277, 671, 697
CviQI GTAC 2 cut(s) 38, 245
DdeI CTNAG 2 cut(s) 297, 605
DpnI GATC 6 cut(s) 159, 295, 310, 415, 500, 570
DpnII GATC 6 cut(s) 157, 293, 308, 413, 498, 568
DraIII CACNNNGTG 1 cut(s) 386
Eam1104I CTCTTC 1 cut(s) 210
EarI CTCTTC 1 cut(s) 210
Eco130I CCWWGG 2 cut(s) 71, 136
Eco57I CTGAAG 2 cut(s) 210, 525
EcoT14I CCWWGG 2 cut(s) 71, 136
ErhI CCWWGG 2 cut(s) 71, 136
FaeI CATG 5 cut(s) 75, 232, 280, 674, 700
FalI AAGNNNNNCTT 2 cut(s) 576, 608
FaqI GGGAC 1 cut(s) 354
FatI CATG 5 cut(s) 71, 228, 276, 670, 696
FbaI TGATCA 1 cut(s) 498
FokI GGATG 3 cut(s) 104, 233, 485
HaeIII GGCC 1 cut(s) 747
Hin1II CATG 5 cut(s) 75, 232, 280, 674, 700
HinfI GANTC 1 cut(s) 232
HphI GGTGA 4 cut(s) 341, 611, 640, 685
Hpy166II GTNNAC 2 cut(s) 40, 245
Hpy188I TCNGA 3 cut(s) 21, 66, 81
Hpy188III TCNNGA 2 cut(s) 236, 422
Hpy8I GTNNAC 2 cut(s) 40, 245
HpyAV CCTTC 3 cut(s) 530, 709, 743
HpyCH4III ACNGT 1 cut(s) 753
HpyCH4IV ACGT 3 cut(s) 6, 397, 645
HpyCH4V TGCA 7 cut(s) 95, 164, 224, 515, 583, 634, 739
HpyF10VI GCNNNNNNNGC 2 cut(s) 185, 521
HpyF3I CTNAG 2 cut(s) 297, 605
HpySE526I ACGT 3 cut(s) 6, 397, 645
Hsp92II CATG 5 cut(s) 75, 232, 280, 674, 700
Ksp22I TGATCA 1 cut(s) 498
Kzo9I GATC 6 cut(s) 157, 293, 308, 413, 498, 568
LmnI GCTCC 2 cut(s) 442, 529
LpnPI CCDG 3 cut(s) 165, 501, 620
LweI GCATC 2 cut(s) 82, 211
MaeII ACGT 3 cut(s) 6, 397, 645
MaeIII GTNAC 3 cut(s) 7, 427, 646
MalI GATC 6 cut(s) 159, 295, 310, 415, 500, 570
MboI GATC 6 cut(s) 157, 293, 308, 413, 498, 568
MboII GAAGA 7 cut(s) 203, 212, 215, 227, 350, 679, 682
MflI RGATCY 2 cut(s) 293, 568
MluCI AATT 3 cut(s) 314, 488, 656
MnlI CCTC 6 cut(s) 211, 232, 313, 600, 675, 700
MseI TTAA 1 cut(s) 546
MslI CAYNNNNRTG 1 cut(s) 129
MwoI GCNNNNNNNGC 2 cut(s) 185, 521
NcoI CCATGG 1 cut(s) 71
NdeII GATC 6 cut(s) 157, 293, 308, 413, 498, 568
NlaIII CATG 5 cut(s) 75, 232, 280, 674, 700
NlaIV GGNNCC 1 cut(s) 525
NmuCI GTSAC 1 cut(s) 646
PfeI GAWTC 1 cut(s) 232
PshBI ATTAAT 1 cut(s) 546
PspN4I GGNNCC 1 cut(s) 525
PsuI RGATCY 2 cut(s) 293, 568
RsaI GTAC 2 cut(s) 39, 246
RsaNI GTAC 2 cut(s) 38, 245
RseI CAYNNNNRTG 1 cut(s) 129
SaqAI TTAA 1 cut(s) 546
Sau3AI GATC 6 cut(s) 157, 293, 308, 413, 498, 568
SfaNI GCATC 2 cut(s) 82, 211
SfcI CTRYAG 1 cut(s) 749
SmiMI CAYNNNNRTG 1 cut(s) 129
SmlI CTYRAG 1 cut(s) 420
SmoI CTYRAG 1 cut(s) 420
Sse9I AATT 3 cut(s) 314, 488, 656
StyI CCWWGG 2 cut(s) 71, 136
TaaI ACNGT 1 cut(s) 753
TaiI ACGT 3 cut(s) 9, 400, 648
TasI AATT 3 cut(s) 314, 488, 656
TfiI GAWTC 1 cut(s) 232
Tru1I TTAA 1 cut(s) 546
Tru9I TTAA 1 cut(s) 546
TscAI CASTG 1 cut(s) 508
TseFI GTSAC 1 cut(s) 646
Tsp45I GTSAC 1 cut(s) 646
TspDTI ATGAA 4 cut(s) 41, 213, 245, 287
TspGWI ACGGA 1 cut(s) 350
TspRI CASTG 1 cut(s) 508
VspI ATTAAT 1 cut(s) 546
XapI RAATTY 1 cut(s) 488
XcmI CCANNNNNNNNNTGG 1 cut(s) 517
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.