Rroxscaffold_7G00182010
MYB Family

DDE superfamily endonuclease

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
21021128 .. 21023591
2464 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00182010.1

Sequence Viewer

Length: 318 bp
ATGCAAGGCAAACTTGGTGGTGAGCTGAGGAAAATGGATTTCCTATCTCCATTGCAGGTATTTCACGTCACCAACAAATTAGCTAAAGAGCATGACTTGTTGAGGGTCTTCTTCACCATGATCGATGAGGAAAAGAAGGATTACATAATCAACCTTCTGCAATATGGCCTACGCAGACATCTAAGTTTGCAAACCAGAATTTTTGATTTTGATAACCATCCTGCATTGTCTCCTTTGGAAAACCCCTTGTCTCTCGAAATTCAGTTGGAAGACACCTCAAACACAGTAGTTTTGAATATATTTGGATATGAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.29

Weight (kDa)

5.3

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 46
AcsI RAATTY 2 cut(s) 198, 258
AgsI TTSAA 1 cut(s) 295
AjiI CACGTC 1 cut(s) 67
AluBI AGCT 2 cut(s) 25, 83
AluI AGCT 2 cut(s) 25, 83
Alw26I GTCTC 2 cut(s) 234, 255
AoxI GGCC 1 cut(s) 166
ApoI RAATTY 2 cut(s) 198, 258
AsuHPI GGTGA 3 cut(s) 32, 61, 106
BbsI GAAGAC 2 cut(s) 100, 276
BbvCI CCTCAGC 1 cut(s) 26
BccI CCATC 1 cut(s) 225
BcoDI GTCTC 2 cut(s) 234, 255
BfuAI ACCTGC 1 cut(s) 46
BmgBI CACGTC 1 cut(s) 67
BpiI GAAGAC 2 cut(s) 100, 276
Bpu10I CCTNAGC 1 cut(s) 26
Bsa29I ATCGAT 1 cut(s) 123
BsaBI GATNNNNATC 1 cut(s) 216
Bse3DI GCAATG 1 cut(s) 50
Bse8I GATNNNNATC 1 cut(s) 216
BseCI ATCGAT 1 cut(s) 123
BseGI GGATG 1 cut(s) 217
BseJI GATNNNNATC 1 cut(s) 216
BseMI GCAATG 1 cut(s) 50
BseMII CTCAG 1 cut(s) 17
BshFI GGCC 1 cut(s) 168
BshVI ATCGAT 1 cut(s) 123
BsmAI GTCTC 2 cut(s) 234, 255
BsnI GGCC 1 cut(s) 168
Bsp143I GATC 1 cut(s) 120
BspANI GGCC 1 cut(s) 168
BspCNI CTCAG 1 cut(s) 18
BspDI ATCGAT 1 cut(s) 123
BspMI ACCTGC 1 cut(s) 46
BsrDI GCAATG 1 cut(s) 50
BssMI GATC 1 cut(s) 120
Bst4CI ACNGT 1 cut(s) 286
BstDEI CTNAG 2 cut(s) 26, 182
BstF5I GGATG 1 cut(s) 217
BstKTI GATC 1 cut(s) 123
BstMAI GTCTC 2 cut(s) 234, 255
BstMBI GATC 1 cut(s) 120
BstV2I GAAGAC 2 cut(s) 100, 276
Bsu15I ATCGAT 1 cut(s) 123
BsuRI GGCC 1 cut(s) 168
BsuTUI ATCGAT 1 cut(s) 123
BtrI CACGTC 1 cut(s) 67
BtsCI GGATG 1 cut(s) 217
BveI ACCTGC 1 cut(s) 46
ClaI ATCGAT 1 cut(s) 123
CspCI CAANNNNNGTGG 1 cut(s) 33
CviAII CATG 2 cut(s) 92, 118
CviJI RGCY 3 cut(s) 25, 83, 168
CviKI_1 RGCY 3 cut(s) 25, 83, 168
DdeI CTNAG 2 cut(s) 26, 182
DpnI GATC 1 cut(s) 122
DpnII GATC 1 cut(s) 120
FaeI CATG 2 cut(s) 95, 121
FaiI YATR 6 cut(s) 93, 119, 146, 165, 299, 309
FalI AAGNNNNNCTT 1 cut(s) 29
FatI CATG 2 cut(s) 91, 117
FokI GGATG 1 cut(s) 204
HaeIII GGCC 1 cut(s) 168
Hin1II CATG 2 cut(s) 95, 121
HphI GGTGA 3 cut(s) 32, 61, 106
Hpy188III TCNNGA 1 cut(s) 254
HpyAV CCTTC 2 cut(s) 130, 164
HpyCH4III ACNGT 1 cut(s) 286
HpyCH4IV ACGT 1 cut(s) 66
HpyCH4V TGCA 5 cut(s) 4, 55, 160, 190, 224
HpyF3I CTNAG 2 cut(s) 26, 182
HpySE526I ACGT 1 cut(s) 66
Hsp92II CATG 2 cut(s) 95, 121
Kzo9I GATC 1 cut(s) 120
LpnPI CCDG 3 cut(s) 41, 208, 234
MaeII ACGT 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 122
MboI GATC 1 cut(s) 120
MboII GAAGA 3 cut(s) 100, 103, 281
MluCI AATT 3 cut(s) 77, 198, 258
MmeI TCCRAC 1 cut(s) 246
MnlI CCTC 4 cut(s) 21, 96, 121, 286
NdeII GATC 1 cut(s) 120
NlaIII CATG 2 cut(s) 95, 121
NmuCI GTSAC 1 cut(s) 67
Sau3AI GATC 1 cut(s) 120
SetI ASST 6 cut(s) 27, 60, 69, 85, 156, 278
Sse9I AATT 3 cut(s) 77, 198, 258
TaaI ACNGT 1 cut(s) 286
TaiI ACGT 1 cut(s) 69
TaqI TCGA 2 cut(s) 123, 255
TasI AATT 3 cut(s) 77, 198, 258
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
XapI RAATTY 2 cut(s) 198, 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.