Rorug05G0372900
MYB Family

DDE superfamily endonuclease

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
50240194 .. 50242506
2313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0372900.1

Sequence Viewer

Length: 411 bp
ATGGGCTACTTTGATTTGGCAGAGATTGCAAAGTTTCTGGGCATTACGAATACAATAGACACAGAAGCCATCCAAGGACGAGGAAGCTACGAAGATCGTACTGAAATGCTTCGTCTAATTGTAGATCTTGTGGAGGCAAGCATTTTTGCTGATAATCAAGAATGGAGTATTGATGAGCAGGTAACAAAGATTGATTCCATTGCTGAAAAGCAAGCTCAAATGTTCTCTGAAGATTGCAAATTGTTTCCTGCTGATGTTCAGATTCAAGCTATATATCCATTATCTAATGTTTCTGAGCTGGAGCAGAAGCTTTCAGAACAATCCAAGACTCTCTTACATCTTCAACAAAAGGTTGATGATTTGGCATCAAAGGTTACTGCTGATGTTGCTACTGCAAATATGCTACATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.27

Weight (kDa)

4.33

Isoelectric Point (pI)

26.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Plant_NMP1 PF06694 6 - 126 1.2e-60 Plant nuclear matrix protein 1 (NMP1)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 169
AcuI CTGAAG 1 cut(s) 249
AfaI GTAC 1 cut(s) 100
AgsI TTSAA 2 cut(s) 266, 344
AluBI AGCT 5 cut(s) 87, 215, 269, 298, 310
AluI AGCT 5 cut(s) 87, 215, 269, 298, 310
Asp700I GAANNNNTTC 1 cut(s) 108
BccI CCATC 1 cut(s) 77
BfuAI ACCTGC 1 cut(s) 169
BglII AGATCT 1 cut(s) 124
BmsI GCATC 1 cut(s) 374
BpmI CTGGAG 1 cut(s) 320
BsaJI CCNNGG 1 cut(s) 73
Bse3DI GCAATG 1 cut(s) 198
BseDI CCNNGG 1 cut(s) 73
BseGI GGATG 1 cut(s) 69
BseMI GCAATG 1 cut(s) 198
BseMII CTCAG 1 cut(s) 285
Bsp143I GATC 2 cut(s) 94, 124
BspCNI CTCAG 1 cut(s) 286
BspMI ACCTGC 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 198
BssECI CCNNGG 1 cut(s) 73
BssMI GATC 2 cut(s) 94, 124
BssT1I CCWWGG 1 cut(s) 73
BstAPI GCANNNNNTGC 1 cut(s) 26
BstC8I GCNNGC 2 cut(s) 139, 213
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 1 cut(s) 69
BstKTI GATC 2 cut(s) 97, 127
BstMBI GATC 2 cut(s) 94, 124
BstMWI GCNNNNNNNGC 2 cut(s) 26, 386
BstX2I RGATCY 1 cut(s) 124
BstYI RGATCY 1 cut(s) 124
BtsCI GGATG 1 cut(s) 69
BveI ACCTGC 1 cut(s) 169
Cac8I GCNNGC 2 cut(s) 139, 213
Csp6I GTAC 1 cut(s) 99
CviJI RGCY 7 cut(s) 6, 68, 87, 215, 269, 298, 310
CviKI_1 RGCY 7 cut(s) 6, 68, 87, 215, 269, 298, 310
CviQI GTAC 1 cut(s) 99
DdeI CTNAG 1 cut(s) 294
DpnI GATC 2 cut(s) 96, 126
DpnII GATC 2 cut(s) 94, 124
Eco130I CCWWGG 1 cut(s) 73
Eco57I CTGAAG 1 cut(s) 249
EcoT14I CCWWGG 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 73
FaiI YATR 3 cut(s) 272, 274, 401
FalI AAGNNNNNCTT 2 cut(s) 317, 349
FokI GGATG 1 cut(s) 56
GsuI CTGGAG 1 cut(s) 320
HindIII AAGCTT 1 cut(s) 308
HinfI GANTC 3 cut(s) 194, 262, 328
Hpy188I TCNGA 4 cut(s) 229, 261, 295, 316
Hpy188III TCNNGA 1 cut(s) 158
HpyCH4V TGCA 3 cut(s) 29, 237, 395
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 386
HpyF3I CTNAG 1 cut(s) 294
Kzo9I GATC 2 cut(s) 94, 124
LmnI GCTCC 1 cut(s) 301
LpnPI CCDG 4 cut(s) 23, 164, 261, 284
LweI GCATC 1 cut(s) 374
MaeIII GTNAC 2 cut(s) 181, 373
MalI GATC 2 cut(s) 96, 126
MboI GATC 2 cut(s) 94, 124
MboII GAAGA 3 cut(s) 104, 242, 332
MflI RGATCY 1 cut(s) 124
MluCI AATT 2 cut(s) 117, 239
MlyI GAGTC 1 cut(s) 322
MnlI CCTC 2 cut(s) 74, 127
MroXI GAANNNNTTC 1 cut(s) 108
MwoI GCNNNNNNNGC 2 cut(s) 26, 386
NdeII GATC 2 cut(s) 94, 124
PdmI GAANNNNTTC 1 cut(s) 108
PfeI GAWTC 2 cut(s) 194, 262
PleI GAGTC 1 cut(s) 322
PpsI GAGTC 1 cut(s) 322
PsuI RGATCY 1 cut(s) 124
RsaI GTAC 1 cut(s) 100
RsaNI GTAC 1 cut(s) 99
Sau3AI GATC 2 cut(s) 94, 124
SchI GAGTC 1 cut(s) 322
SetI ASST 8 cut(s) 89, 183, 217, 271, 300, 312, 354, 375
SfaNI GCATC 1 cut(s) 374
Sse9I AATT 2 cut(s) 117, 239
StyI CCWWGG 1 cut(s) 73
TasI AATT 2 cut(s) 117, 239
TfiI GAWTC 2 cut(s) 194, 262
XmnI GAANNNNTTC 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.