Rh1BG202800
MYB Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0000883
Physical Location & Seq
Reverse (-)
32029754 .. 32030220
467 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG202800.1

Sequence Viewer

Length: 201 bp
ATGGCTCCAAAGTTTGAAGGCCTGATTAATGTTCTCTCAACAGATAAGGATCTTGCTGATATGCAAGGCAAACTTGGTGGTGAGCTGAGGAAAATGGATTTCCTATCTCCATTGCAGTTATTTGAAATTGGTACTCGGTGTTATTTCCTTCTATGGACTTTCGAGCTTCTGGTGCTTTCTATTCCTTACGTTCCTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

66

Amino Acids

7.49

Weight (kDa)

4.77

Isoelectric Point (pI)

37.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 57
AfaI GTAC 1 cut(s) 133
AgsI TTSAA 2 cut(s) 17, 125
AluBI AGCT 2 cut(s) 85, 166
AluI AGCT 2 cut(s) 85, 166
AlwI GGATC 1 cut(s) 57
AoxI GGCC 1 cut(s) 19
AseI ATTAAT 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 92
BbvCI CCTCAGC 1 cut(s) 86
BmiI GGNNCC 1 cut(s) 6
Bpu10I CCTNAGC 1 cut(s) 86
BsaBI GATNNNNATC 1 cut(s) 48
Bse3DI GCAATG 1 cut(s) 110
Bse8I GATNNNNATC 1 cut(s) 48
BseJI GATNNNNATC 1 cut(s) 48
BseMI GCAATG 1 cut(s) 110
BseMII CTCAG 1 cut(s) 77
BshFI GGCC 1 cut(s) 21
BsnI GGCC 1 cut(s) 21
Bsp143I GATC 1 cut(s) 49
BspANI GGCC 1 cut(s) 21
BspCNI CTCAG 1 cut(s) 78
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 57
BsrDI GCAATG 1 cut(s) 110
BssMI GATC 1 cut(s) 49
BstDEI CTNAG 2 cut(s) 86, 198
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BstMWI GCNNNNNNNGC 1 cut(s) 172
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BsuRI GGCC 1 cut(s) 21
Csp6I GTAC 1 cut(s) 132
CspCI CAANNNNNGTGG 2 cut(s) 58, 93
CviJI RGCY 4 cut(s) 5, 21, 85, 166
CviKI_1 RGCY 4 cut(s) 5, 21, 85, 166
CviQI GTAC 1 cut(s) 132
DdeI CTNAG 2 cut(s) 86, 198
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
Eco147I AGGCCT 1 cut(s) 21
FaiI YATR 2 cut(s) 62, 154
FalI AAGNNNNNCTT 2 cut(s) 57, 89
HaeIII GGCC 1 cut(s) 21
HphI GGTGA 1 cut(s) 92
HpyAV CCTTC 2 cut(s) 11, 158
HpyCH4IV ACGT 1 cut(s) 189
HpyCH4V TGCA 2 cut(s) 64, 115
HpyF10VI GCNNNNNNNGC 1 cut(s) 172
HpyF3I CTNAG 2 cut(s) 86, 198
HpySE526I ACGT 1 cut(s) 189
Kzo9I GATC 1 cut(s) 49
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 2 cut(s) 35, 155
MaeII ACGT 1 cut(s) 189
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MflI RGATCY 1 cut(s) 49
MluCI AATT 1 cut(s) 126
MnlI CCTC 1 cut(s) 81
MseI TTAA 1 cut(s) 27
MwoI GCNNNNNNNGC 1 cut(s) 172
NdeII GATC 1 cut(s) 49
NlaIV GGNNCC 1 cut(s) 6
PceI AGGCCT 1 cut(s) 21
PshBI ATTAAT 1 cut(s) 27
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 49
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 49
SetI ASST 3 cut(s) 87, 168, 192
SgeI CNNG 7 cut(s) 34, 65, 77, 86, 147, 175, 182
Sse9I AATT 1 cut(s) 126
SseBI AGGCCT 1 cut(s) 21
StuI AGGCCT 1 cut(s) 21
TaiI ACGT 1 cut(s) 192
TaqI TCGA 1 cut(s) 162
TasI AATT 1 cut(s) 126
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
VspI ATTAAT 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.