Rmu_sc0005168.1_g000016

Zinc finger A20 and AN1 domain-containing stress-associated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005168.1
Physical Location & Seq
Reverse (-)
76244 .. 76549
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005168.1_g000016.1.cds

Sequence Viewer

Length: 306 bp
atggagcacaacaagacaggatgccaaacacgtccagaagctcccaaactttgtatcaataactgtggattctttggaagtgtagcaaccatgaacttgtgttccaaatgccacaaggacttggtactgaagcaagaacaagccaaagttcctgcagtgtccattgaaagtgctgtgaatgccaatcccaataactggggaaatgagcatgctgtgactttagatatacaagctggttcaacatatttgcctcttatctcagctgaggcatccagtactccgcctccaaacaatgaggatatataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

10.82

Weight (kDa)

5.47

Isoelectric Point (pI)

41.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 195
AciI CCGC 1 cut(s) 281
AcuI CTGAAG 1 cut(s) 149
AfaI GTAC 2 cut(s) 126, 277
AfiI CCNNNNNNNGG 1 cut(s) 195
AflIII ACRYGT 1 cut(s) 29
AgsI TTSAA 2 cut(s) 167, 240
AjiI CACGTC 1 cut(s) 32
AloI GAACNNNNNNTCC 2 cut(s) 86, 118
AluBI AGCT 3 cut(s) 41, 233, 263
AluI AGCT 3 cut(s) 41, 233, 263
Alw21I GWGCWC 1 cut(s) 9
Bbv12I GWGCWC 1 cut(s) 9
BbvCI CCTCAGC 1 cut(s) 264
BfmI CTRYAG 1 cut(s) 153
BmcAI AGTACT 1 cut(s) 277
BmgBI CACGTC 1 cut(s) 32
BmrI ACTGGG 1 cut(s) 205
BmsI GCATC 2 cut(s) 11, 278
BmuI ACTGGG 1 cut(s) 205
Bpu10I CCTNAGC 1 cut(s) 264
BsaXI ACNNNNNCTCC 2 cut(s) 268, 298
Bsc4I CCNNNNNNNGG 1 cut(s) 195
Bse1I ACTGG 2 cut(s) 200, 273
BseGI GGATG 2 cut(s) 26, 269
BseLI CCNNNNNNNGG 1 cut(s) 195
BseMII CTCAG 2 cut(s) 255, 273
BseNI ACTGG 2 cut(s) 200, 273
BsiHKAI GWGCWC 1 cut(s) 9
BslI CCNNNNNNNGG 1 cut(s) 195
BsmI GAATGC 1 cut(s) 184
Bsp1286I GDGCHC 1 cut(s) 9
BspACI CCGC 1 cut(s) 281
BspCNI CTCAG 2 cut(s) 256, 272
BspMAI CTGCAG 1 cut(s) 157
BsrI ACTGG 2 cut(s) 200, 273
Bst4CI ACNGT 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 2 cut(s) 259, 264
BstF5I GGATG 2 cut(s) 26, 269
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstNSI RCATGY 1 cut(s) 212
BstSFI CTRYAG 1 cut(s) 153
BtrI CACGTC 1 cut(s) 32
BtsCI GGATG 2 cut(s) 26, 269
BtsI GCAGTG 1 cut(s) 162
BtsIMutI CAGTG 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 210
Csp6I GTAC 2 cut(s) 125, 276
CspCI CAANNNNNGTGG 2 cut(s) 46, 81
CviAII CATG 2 cut(s) 91, 209
CviJI RGCY 4 cut(s) 41, 143, 233, 263
CviKI_1 RGCY 4 cut(s) 41, 143, 233, 263
CviQI GTAC 2 cut(s) 125, 276
DdeI CTNAG 2 cut(s) 259, 264
EciI GGCGGA 1 cut(s) 270
Eco57I CTGAAG 1 cut(s) 149
FaeI CATG 2 cut(s) 94, 212
FaiI YATR 6 cut(s) 92, 210, 227, 244, 302, 304
FatI CATG 2 cut(s) 90, 208
FokI GGATG 2 cut(s) 33, 256
Hin1II CATG 2 cut(s) 94, 212
HinfI GANTC 1 cut(s) 69
Hpy188III TCNNGA 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 65
HpyCH4IV ACGT 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
HpyF3I CTNAG 2 cut(s) 259, 264
HpySE526I ACGT 1 cut(s) 31
Hsp92II CATG 2 cut(s) 94, 212
LmnI GCTCC 2 cut(s) 4, 46
LpnPI CCDG 6 cut(s) 3, 48, 165, 181, 219, 286
LweI GCATC 2 cut(s) 11, 278
MaeII ACGT 1 cut(s) 31
MaeIII GTNAC 1 cut(s) 214
MhlI GDGCHC 1 cut(s) 9
MnlI CCTC 4 cut(s) 259, 261, 289, 294
MspA1I CMGCKG 1 cut(s) 263
Mva1269I GAATGC 1 cut(s) 184
MwoI GCNNNNNNNGC 1 cut(s) 179
NlaIII CATG 2 cut(s) 94, 212
NmuCI GTSAC 1 cut(s) 214
NspI RCATGY 1 cut(s) 212
PaeI GCATGC 1 cut(s) 212
PctI GAATGC 1 cut(s) 184
PfeI GAWTC 1 cut(s) 69
PflMI CCANNNNNTGG 1 cut(s) 195
PstI CTGCAG 1 cut(s) 157
PvuII CAGCTG 1 cut(s) 263
RsaI GTAC 2 cut(s) 126, 277
RsaNI GTAC 2 cut(s) 125, 276
ScaI AGTACT 1 cut(s) 277
SduI GDGCHC 1 cut(s) 9
SetI ASST 4 cut(s) 34, 43, 235, 265
SfaNI GCATC 2 cut(s) 11, 278
SfcI CTRYAG 1 cut(s) 153
SphI GCATGC 1 cut(s) 212
SsiI CCGC 1 cut(s) 281
TaaI ACNGT 1 cut(s) 65
TaiI ACGT 1 cut(s) 34
TatI WGTACW 1 cut(s) 275
TfiI GAWTC 1 cut(s) 69
TscAI CASTG 1 cut(s) 162
TseFI GTSAC 1 cut(s) 214
Tsp45I GTSAC 1 cut(s) 214
TspDTI ATGAA 1 cut(s) 107
TspRI CASTG 1 cut(s) 162
Van91I CCANNNNNTGG 1 cut(s) 195
XceI RCATGY 1 cut(s) 212
ZrmI AGTACT 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.