Rorug03G0187500

Zinc finger A20 and AN1 domain-containing stress-associated protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
16314698 .. 16315177
480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0187500.1

Sequence Viewer

Length: 234 bp
ATGCCTGCTTTAGAAAGTAGTAAAATGATGCAACATCTTACTGCAATCTGTGGGGTTTTAACACTTTTGTTGCCTATTTTGAATCAACAACAGGGTCGTGTCAAGCAGAAGCTATCATCAGGAGGCAAATATGTGTCTGTAAACATTGGTCCTGTTCAAGTCATTTCTAGTGAACAGGTCCAAGCTGTATACAATGCAATGAGAAGAGATGACCGGATGAAATACTTTTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.61

Weight (kDa)

9.8

Isoelectric Point (pI)

57.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF493 PF04359 16 - 77 1.1e-11 Protein of unknown function (DUF493)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 189
AgsI TTSAA 2 cut(s) 82, 158
AluBI AGCT 2 cut(s) 112, 185
AluI AGCT 2 cut(s) 112, 185
AspS9I GGNCC 2 cut(s) 149, 178
AvaII GGWCC 2 cut(s) 149, 178
BfaI CTAG 1 cut(s) 168
Bme18I GGWCC 2 cut(s) 149, 178
BmgT120I GGNCC 2 cut(s) 149, 178
BmsI GCATC 1 cut(s) 18
BsaWI WCCGGW 1 cut(s) 213
Bse3DI GCAATG 1 cut(s) 204
BseGI GGATG 1 cut(s) 222
BseMI GCAATG 1 cut(s) 204
BsiSI CCGG 1 cut(s) 214
BsrDI GCAATG 1 cut(s) 204
BssNAI GTATAC 1 cut(s) 190
Bst1107I GTATAC 1 cut(s) 190
Bst6I CTCTTC 1 cut(s) 199
BstC8I GCNNGC 1 cut(s) 6
BstF5I GGATG 1 cut(s) 222
BstZ17I GTATAC 1 cut(s) 190
BtsCI GGATG 1 cut(s) 222
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 2 cut(s) 149, 178
CviJI RGCY 2 cut(s) 112, 185
CviKI_1 RGCY 2 cut(s) 112, 185
Eam1104I CTCTTC 1 cut(s) 199
EarI CTCTTC 1 cut(s) 199
Eco47I GGWCC 2 cut(s) 149, 178
FaiI YATR 2 cut(s) 132, 190
FblI GTMKAC 1 cut(s) 189
FokI GGATG 1 cut(s) 229
FspBI CTAG 1 cut(s) 168
HapII CCGG 1 cut(s) 214
HinfI GANTC 1 cut(s) 82
HpaII CCGG 1 cut(s) 214
Hpy166II GTNNAC 3 cut(s) 142, 173, 190
Hpy188III TCNNGA 1 cut(s) 120
Hpy8I GTNNAC 3 cut(s) 142, 173, 190
HpyCH4V TGCA 3 cut(s) 31, 44, 197
LpnPI CCDG 6 cut(s) 18, 77, 105, 161, 165, 227
LweI GCATC 1 cut(s) 18
MaeI CTAG 1 cut(s) 168
MboII GAAGA 1 cut(s) 216
MnlI CCTC 1 cut(s) 116
MseI TTAA 1 cut(s) 59
MspI CCGG 1 cut(s) 214
PfeI GAWTC 1 cut(s) 82
PspPI GGNCC 2 cut(s) 149, 178
SaqAI TTAA 1 cut(s) 59
Sau96I GGNCC 2 cut(s) 149, 178
SetI ASST 3 cut(s) 114, 180, 187
SfaNI GCATC 1 cut(s) 18
SinI GGWCC 2 cut(s) 149, 178
SspMI CTAG 1 cut(s) 168
TfiI GAWTC 1 cut(s) 82
Tru1I TTAA 1 cut(s) 59
Tru9I TTAA 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 233
VpaK11BI GGWCC 2 cut(s) 149, 178
XmiI GTMKAC 1 cut(s) 189
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.