Rmu_sc0013573.1_g000001

Zinc finger A20 and AN1 domain-containing stress-associated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013573.1
Physical Location & Seq
Reverse (-)
1952 .. 2467
516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013573.1_g000001.1.cds

Sequence Viewer

Length: 516 bp
atggactctcacgatgaaactggatgccaagctccagaccgccccatcctttgcattaataactgtggcttcttcggaagggcagctacaatgaatatgtgttccaaatgttacaaggacatgcttctaaagcaggagcaggccgatctggcagcaacatccattggtagccttgtgaatggcaacaatagtggcattggccctgttgttgctaatgctgtcgatgtgcaagctggacaagttgaggcggtggttatttcaacagagccatcttgtggctcatcctcaagcaaagttactgatgaggtgaaagaaatagctggaccaaagagatgcactacttgccgaaagcgtgttggtctaactgggttcaattgcaaatgtggaaataccttctgttcaactcatcgctattctgacaaacatgactgcccttttgattataggactgctggtcgggatgctattgctaaagccaatcctgttgtcaaggcagagaaacttgataagatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

171

Amino Acids

18.25

Weight (kDa)

7.95

Isoelectric Point (pI)

26.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 275
AciI CCGC 2 cut(s) 40, 248
AfiI CCNNNNNNNGG 1 cut(s) 275
AgsI TTSAA 3 cut(s) 261, 373, 402
AhdI GACNNNNNGTC 1 cut(s) 453
AluBI AGCT 4 cut(s) 32, 86, 233, 320
AluI AGCT 4 cut(s) 32, 86, 233, 320
AoxI GGCC 2 cut(s) 141, 199
ApeKI GCWGC 2 cut(s) 83, 152
ArsI GACNNNNNNTTYG 2 cut(s) 419, 451
AseI ATTAAT 1 cut(s) 57
AspS9I GGNCC 2 cut(s) 200, 323
AsuHPI GGTGA 1 cut(s) 319
AvaII GGWCC 1 cut(s) 323
BarI GAAGNNNNNNTAC 2 cut(s) 70, 102
BbvI GCAGC 2 cut(s) 95, 164
BccI CCATC 2 cut(s) 53, 277
BfaI CTAG 1 cut(s) 514
BglI GCCNNNNNGGC 1 cut(s) 149
BglII AGATCT 1 cut(s) 510
BisI GCNGC 2 cut(s) 84, 153
BlsI GCNGC 2 cut(s) 85, 154
Bme18I GGWCC 1 cut(s) 323
BmeRI GACNNNNNGTC 1 cut(s) 453
BmgT120I GGNCC 2 cut(s) 200, 323
BmrI ACTGGG 1 cut(s) 375
BmsI GCATC 3 cut(s) 14, 323, 451
BmuI ACTGGG 1 cut(s) 375
BpmI CTGGAG 1 cut(s) 18
BpuEI CTTGAG 1 cut(s) 271
Bsc4I CCNNNNNNNGG 1 cut(s) 275
Bse1I ACTGG 2 cut(s) 25, 370
BseGI GGATG 5 cut(s) 29, 45, 158, 281, 466
BseLI CCNNNNNNNGG 1 cut(s) 275
BseNI ACTGG 2 cut(s) 25, 370
BseXI GCAGC 2 cut(s) 95, 164
BshFI GGCC 2 cut(s) 143, 201
BslI CCNNNNNNNGG 1 cut(s) 275
BsnI GGCC 2 cut(s) 143, 201
Bsp143I GATC 2 cut(s) 145, 510
BspACI CCGC 2 cut(s) 40, 248
BspANI GGCC 2 cut(s) 143, 201
BsrI ACTGG 2 cut(s) 25, 370
BssMI GATC 2 cut(s) 145, 510
Bst4CI ACNGT 1 cut(s) 65
BstAPI GCANNNNNTGC 1 cut(s) 342
BstC8I GCNNGC 2 cut(s) 141, 231
BstF5I GGATG 5 cut(s) 29, 45, 158, 281, 466
BstKTI GATC 2 cut(s) 148, 513
BstMBI GATC 2 cut(s) 145, 510
BstMWI GCNNNNNNNGC 3 cut(s) 130, 149, 342
BstNSI RCATGY 1 cut(s) 124
BstV1I GCAGC 2 cut(s) 95, 164
BstX2I RGATCY 1 cut(s) 510
BstYI RGATCY 1 cut(s) 510
BsuRI GGCC 2 cut(s) 143, 201
BtgZI GCGATG 1 cut(s) 392
BtsCI GGATG 5 cut(s) 29, 45, 158, 281, 466
Cac8I GCNNGC 2 cut(s) 141, 231
Cfr13I GGNCC 2 cut(s) 200, 323
CspCI CAANNNNNGTGG 2 cut(s) 172, 207
CviAII CATG 2 cut(s) 121, 425
DpnI GATC 2 cut(s) 147, 512
DpnII GATC 2 cut(s) 145, 510
DriI GACNNNNNGTC 1 cut(s) 453
Eam1105I GACNNNNNGTC 1 cut(s) 453
Eco47I GGWCC 1 cut(s) 323
FaeI CATG 2 cut(s) 124, 428
FaiI YATR 4 cut(s) 98, 122, 426, 444
FatI CATG 2 cut(s) 120, 424
Fnu4HI GCNGC 2 cut(s) 84, 153
FokI GGATG 5 cut(s) 32, 36, 145, 268, 473
Fsp4HI GCNGC 2 cut(s) 84, 153
FspBI CTAG 1 cut(s) 514
GluI GCNGC 2 cut(s) 84, 153
GsuI CTGGAG 1 cut(s) 18
HaeIII GGCC 2 cut(s) 143, 201
Hin1II CATG 2 cut(s) 124, 428
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 319
Hpy188I TCNGA 2 cut(s) 77, 418
Hpy188III TCNNGA 3 cut(s) 11, 35, 458
HpyAV CCTTC 2 cut(s) 72, 403
HpyCH4III ACNGT 1 cut(s) 65
HpyCH4V TGCA 4 cut(s) 54, 229, 336, 378
HpyF10VI GCNNNNNNNGC 3 cut(s) 130, 149, 342
Hsp92II CATG 2 cut(s) 124, 428
Kzo9I GATC 2 cut(s) 145, 510
LmnI GCTCC 2 cut(s) 37, 136
Lsp1109I GCAGC 2 cut(s) 95, 164
LweI GCATC 3 cut(s) 14, 323, 451
MaeI CTAG 1 cut(s) 514
MaeIII GTNAC 2 cut(s) 110, 295
MalI GATC 2 cut(s) 147, 512
MboI GATC 2 cut(s) 145, 510
MboII GAAGA 1 cut(s) 64
MfeI CAATTG 1 cut(s) 373
MflI RGATCY 1 cut(s) 510
MluCI AATT 1 cut(s) 373
MnlI CCTC 3 cut(s) 238, 295, 298
MseI TTAA 1 cut(s) 57
MunI CAATTG 1 cut(s) 373
MwoI GCNNNNNNNGC 3 cut(s) 130, 149, 342
NdeII GATC 2 cut(s) 145, 510
NlaIII CATG 2 cut(s) 124, 428
NspI RCATGY 1 cut(s) 124
PflMI CCANNNNNTGG 1 cut(s) 275
PkrI GCNGC 2 cut(s) 85, 154
PshBI ATTAAT 1 cut(s) 57
PspPI GGNCC 2 cut(s) 200, 323
PsuI RGATCY 1 cut(s) 510
SaqAI TTAA 1 cut(s) 57
SatI GCNGC 2 cut(s) 84, 153
Sau3AI GATC 2 cut(s) 145, 510
Sau96I GGNCC 2 cut(s) 200, 323
SetI ASST 6 cut(s) 34, 88, 235, 309, 322, 395
SfaNI GCATC 3 cut(s) 14, 323, 451
SinI GGWCC 1 cut(s) 323
SmlI CTYRAG 1 cut(s) 286
SmoI CTYRAG 1 cut(s) 286
Sse9I AATT 1 cut(s) 373
SsiI CCGC 2 cut(s) 40, 248
SspMI CTAG 1 cut(s) 514
TaaI ACNGT 1 cut(s) 65
TaqI TCGA 1 cut(s) 222
TasI AATT 1 cut(s) 373
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TseI GCWGC 2 cut(s) 83, 152
TspDTI ATGAA 2 cut(s) 30, 107
Van91I CCANNNNNTGG 1 cut(s) 275
VpaK11BI GGWCC 1 cut(s) 323
VspI ATTAAT 1 cut(s) 57
XceI RCATGY 1 cut(s) 124
XspI CTAG 1 cut(s) 514
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.