Rmu_sc0011563.1_g000010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011563.1
OG0000643
Physical Location & Seq
Reverse (-)
29234 .. 29665
432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011563.1_g000010.1.cds

Sequence Viewer

Length: 363 bp
atgatggaaacaaagttatggttgatatcccagcatctcaaatgcgacttgagtccctctcaactgccggatgatgataaggaagatgggagccggtgtgagaggaagcgcgtgtcattggtggggaagccacgtggcattgggagggaggggtcaaggagcgttggaccggagagtaggatgaagaagaggtgggaggaggttcctagtgaggtggtggtgttccagggtttggaggaggacggtgttgcagaaatgggtgatgtggcggaattgattgagatgaagaagtattttagcaacagtaatgaggtctgccaggaattgagttttgcagaagaggaggacggtgaagaagaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

13.64

Weight (kDa)

4.6

Isoelectric Point (pI)

68.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 232
AccII CGCG 1 cut(s) 111
AciI CCGC 1 cut(s) 269
AcvI CACGTG 1 cut(s) 134
AfiI CCNNNNNNNGG 1 cut(s) 232
AjnI CCWGG 2 cut(s) 225, 318
AspLEI GCGC 1 cut(s) 111
AspS9I GGNCC 1 cut(s) 167
AsuHPI GGTGA 2 cut(s) 272, 362
AvaII GGWCC 1 cut(s) 167
BbrPI CACGTG 1 cut(s) 134
BccI CCATC 1 cut(s) 80
BciT130I CCWGG 2 cut(s) 227, 320
BfaI CTAG 1 cut(s) 207
Bme1390I CCNGG 2 cut(s) 227, 320
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BmiI GGNNCC 2 cut(s) 92, 204
BmrFI CCNGG 2 cut(s) 227, 320
BmsI GCATC 1 cut(s) 43
BoxI GACNNNNGTC 1 cut(s) 51
BplI GAGNNNNNCTC 2 cut(s) 43, 75
BpuEI CTTGAG 1 cut(s) 70
BsaAI YACGTR 1 cut(s) 134
BsaJI CCNNGG 1 cut(s) 226
BsaWI WCCGGW 1 cut(s) 169
BsaXI ACNNNNNCTCC 2 cut(s) 82, 112
Bsc4I CCNNNNNNNGG 1 cut(s) 232
Bse118I RCCGGY 1 cut(s) 93
BseBI CCWGG 2 cut(s) 227, 320
BseDI CCNNGG 1 cut(s) 226
BseGI GGATG 2 cut(s) 76, 186
BseLI CCNNNNNNNGG 1 cut(s) 232
BseRI GAGGAG 3 cut(s) 212, 251, 356
BseYI CCCAGC 1 cut(s) 30
Bsh1236I CGCG 1 cut(s) 111
BsiSI CCGG 3 cut(s) 68, 94, 170
BslFI GGGAC 1 cut(s) 39
BslI CCNNNNNNNGG 1 cut(s) 232
BsmFI GGGAC 1 cut(s) 39
BspACI CCGC 1 cut(s) 269
BspFNI CGCG 1 cut(s) 111
BspLI GGNNCC 2 cut(s) 92, 204
BsrFI RCCGGY 1 cut(s) 93
BssAI RCCGGY 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 226
Bst2UI CCWGG 2 cut(s) 227, 320
Bst4CI ACNGT 3 cut(s) 245, 305, 350
Bst6I CTCTTC 2 cut(s) 182, 333
BstBAI YACGTR 1 cut(s) 134
BstF5I GGATG 2 cut(s) 76, 186
BstFNI CGCG 1 cut(s) 111
BstHHI GCGC 1 cut(s) 111
BstNI CCWGG 2 cut(s) 227, 320
BstPAI GACNNNNGTC 1 cut(s) 51
BstSCI CCNGG 2 cut(s) 225, 318
BstUI CGCG 1 cut(s) 111
BtsCI GGATG 2 cut(s) 76, 186
CfoI GCGC 1 cut(s) 111
Cfr10I RCCGGY 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 167
CviJI RGCY 2 cut(s) 93, 130
CviKI_1 RGCY 2 cut(s) 93, 130
Eam1104I CTCTTC 2 cut(s) 182, 333
EarI CTCTTC 2 cut(s) 182, 333
EciI GGCGGA 1 cut(s) 284
Eco32I GATATC 1 cut(s) 27
Eco47I GGWCC 1 cut(s) 167
Eco72I CACGTG 1 cut(s) 134
EcoRII CCWGG 2 cut(s) 225, 318
EcoRV GATATC 1 cut(s) 27
FaiI YATR 1 cut(s) 19
FaqI GGGAC 1 cut(s) 39
FokI GGATG 2 cut(s) 83, 193
FspBI CTAG 1 cut(s) 207
GlaI GCGC 1 cut(s) 110
GsaI CCCAGC 1 cut(s) 34
HapII CCGG 3 cut(s) 68, 94, 170
HhaI GCGC 1 cut(s) 111
Hin6I GCGC 1 cut(s) 109
HinP1I GCGC 1 cut(s) 109
HinfI GANTC 1 cut(s) 52
HpaII CCGG 3 cut(s) 68, 94, 170
HphI GGTGA 2 cut(s) 272, 362
HpyCH4III ACNGT 3 cut(s) 245, 305, 350
HpyCH4IV ACGT 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 251, 335
HpySE526I ACGT 1 cut(s) 133
HspAI GCGC 1 cut(s) 109
LmnI GCTCC 2 cut(s) 90, 159
LpnPI CCDG 8 cut(s) 44, 81, 107, 183, 212, 239, 305, 332
LweI GCATC 1 cut(s) 43
MaeI CTAG 1 cut(s) 207
MaeII ACGT 1 cut(s) 133
MboII GAAGA 5 cut(s) 95, 196, 199, 298, 350
MluCI AATT 2 cut(s) 272, 323
MlyI GAGTC 1 cut(s) 61
MmeI TCCRAC 1 cut(s) 145
MspI CCGG 3 cut(s) 68, 94, 170
MspR9I CCNGG 2 cut(s) 227, 320
MvaI CCWGG 2 cut(s) 227, 320
MvnI CGCG 1 cut(s) 111
NlaIV GGNNCC 2 cut(s) 92, 204
PflMI CCANNNNNTGG 1 cut(s) 232
PleI GAGTC 1 cut(s) 60
PmaCI CACGTG 1 cut(s) 134
PmlI CACGTG 1 cut(s) 134
PpsI GAGTC 1 cut(s) 60
Ppu21I YACGTR 1 cut(s) 134
PshAI GACNNNNGTC 1 cut(s) 51
Psp6I CCWGG 2 cut(s) 225, 318
PspCI CACGTG 1 cut(s) 134
PspFI CCCAGC 1 cut(s) 30
PspGI CCWGG 2 cut(s) 225, 318
PspN4I GGNNCC 2 cut(s) 92, 204
PspPI GGNCC 1 cut(s) 167
Sau96I GGNCC 1 cut(s) 167
SchI GAGTC 1 cut(s) 61
ScrFI CCNGG 2 cut(s) 227, 320
SetI ASST 5 cut(s) 136, 194, 204, 216, 315
SfaNI GCATC 1 cut(s) 43
SinI GGWCC 1 cut(s) 167
SmlI CTYRAG 1 cut(s) 49
SmoI CTYRAG 1 cut(s) 49
Sse9I AATT 2 cut(s) 272, 323
SsiI CCGC 1 cut(s) 269
SspMI CTAG 1 cut(s) 207
StyD4I CCNGG 2 cut(s) 225, 318
TaaI ACNGT 3 cut(s) 245, 305, 350
TaiI ACGT 1 cut(s) 136
TasI AATT 2 cut(s) 272, 323
TspDTI ATGAA 2 cut(s) 197, 299
Van91I CCANNNNNTGG 1 cut(s) 232
VpaK11BI GGWCC 1 cut(s) 167
XspI CTAG 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.