Rh7AG194200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0000643
Physical Location & Seq
Forward (+)
17395906 .. 17396130
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG194200.1

Sequence Viewer

Length: 225 bp
ATGTCGTTTAAGCCACTGAACGAAAATTCGCGGCGGCTATTGGTGGCGCCGAAGAAGATGGGGTTTGAGGTTGAAGAAGAGAAAGGTCGAGACCTGGGGAAGATCAATTTAGAGATTGAGGAAATCAAGAAGGAGATAAGCCGATTGAATTCGAGGCTGGAATTGTGGGAACTAGAGAAGGCTCAGAAGAGAAGCGCAGCAAAGTTGTGGAGGCGAATTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.8

Weight (kDa)

9.81

Isoelectric Point (pI)

81.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 46
AccII CGCG 1 cut(s) 31
AciI CCGC 2 cut(s) 31, 34
AcsI RAATTY 3 cut(s) 25, 148, 216
AcyI GRCGYC 1 cut(s) 47
AgsI TTSAA 2 cut(s) 74, 148
AjnI CCWGG 1 cut(s) 93
Alw26I GTCTC 1 cut(s) 84
ApeKI GCWGC 1 cut(s) 197
ApoI RAATTY 3 cut(s) 25, 148, 216
AspLEI GCGC 2 cut(s) 49, 197
BanI GGYRCC 1 cut(s) 46
BbvI GCAGC 1 cut(s) 209
BccI CCATC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 95
BcoDI GTCTC 1 cut(s) 84
BfaI CTAG 1 cut(s) 173
BfoI RGCGCY 1 cut(s) 50
BisI GCNGC 3 cut(s) 32, 35, 198
BlsI GCNGC 3 cut(s) 33, 36, 199
Bme1390I CCNGG 1 cut(s) 95
BmiI GGNNCC 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 95
BsaHI GRCGYC 1 cut(s) 47
BsaI GGTCTC 1 cut(s) 84
BsaJI CCNNGG 1 cut(s) 94
BseBI CCWGG 1 cut(s) 95
BseDI CCNNGG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 197
BseXI GCAGC 1 cut(s) 209
Bsh1236I CGCG 1 cut(s) 31
BshNI GGYRCC 1 cut(s) 46
BsmAI GTCTC 1 cut(s) 84
Bso31I GGTCTC 1 cut(s) 84
Bsp143I GATC 1 cut(s) 102
BspACI CCGC 2 cut(s) 31, 34
BspCNI CTCAG 1 cut(s) 196
BspFNI CGCG 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 48
BspT107I GGYRCC 1 cut(s) 46
BspTNI GGTCTC 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 94
BssMI GATC 1 cut(s) 102
BssNI GRCGYC 1 cut(s) 47
Bst2UI CCWGG 1 cut(s) 95
Bst6I CTCTTC 2 cut(s) 72, 182
BstACI GRCGYC 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 183
BstFNI CGCG 1 cut(s) 31
BstH2I RGCGCY 1 cut(s) 50
BstHHI GCGC 2 cut(s) 49, 197
BstKTI GATC 1 cut(s) 105
BstMAI GTCTC 1 cut(s) 84
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 93
BstUI CGCG 1 cut(s) 31
BstV1I GCAGC 1 cut(s) 209
BtsIMutI CAGTG 1 cut(s) 14
CfoI GCGC 2 cut(s) 49, 197
CviJI RGCY 5 cut(s) 13, 37, 141, 157, 182
CviKI_1 RGCY 5 cut(s) 13, 37, 141, 157, 182
DdeI CTNAG 1 cut(s) 183
DinI GGCGCC 1 cut(s) 48
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
Eam1104I CTCTTC 2 cut(s) 72, 182
EarI CTCTTC 2 cut(s) 72, 182
Eco31I GGTCTC 1 cut(s) 84
EcoRI GAATTC 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 93
EgeI GGCGCC 1 cut(s) 48
EheI GGCGCC 1 cut(s) 48
FaiI YATR 1 cut(s) 223
Fnu4HI GCNGC 3 cut(s) 32, 35, 198
Fsp4HI GCNGC 3 cut(s) 32, 35, 198
FspBI CTAG 1 cut(s) 173
GlaI GCGC 2 cut(s) 48, 196
GluI GCNGC 3 cut(s) 32, 35, 198
HaeII RGCGCY 1 cut(s) 50
HhaI GCGC 2 cut(s) 49, 197
Hin1I GRCGYC 1 cut(s) 47
Hin6I GCGC 2 cut(s) 47, 195
HinP1I GCGC 2 cut(s) 47, 195
Hpy188I TCNGA 1 cut(s) 186
Hpy188III TCNNGA 2 cut(s) 89, 127
HpyAV CCTTC 2 cut(s) 124, 172
HpyF3I CTNAG 1 cut(s) 183
Hsp92I GRCGYC 1 cut(s) 47
HspAI GCGC 2 cut(s) 47, 195
KasI GGCGCC 1 cut(s) 46
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 3 cut(s) 80, 107, 143
Lsp1109I GCAGC 1 cut(s) 209
MaeI CTAG 1 cut(s) 173
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 6 cut(s) 64, 67, 86, 89, 112, 199
MluCI AATT 5 cut(s) 25, 106, 148, 161, 216
Mly113I GGCGCC 1 cut(s) 47
MnlI CCTC 4 cut(s) 61, 112, 147, 204
MseI TTAA 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 95
MvaI CCWGG 1 cut(s) 95
MvnI CGCG 1 cut(s) 31
NarI GGCGCC 1 cut(s) 47
NdeII GATC 1 cut(s) 102
NlaIV GGNNCC 1 cut(s) 48
PkrI GCNGC 3 cut(s) 33, 36, 199
PluTI GGCGCC 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 93
PspGI CCWGG 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 48
SaqAI TTAA 1 cut(s) 9
SatI GCNGC 3 cut(s) 32, 35, 198
Sau3AI GATC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 95
SetI ASST 3 cut(s) 72, 88, 96
SfoI GGCGCC 1 cut(s) 48
SgeI CNNG 8 cut(s) 42, 101, 106, 107, 139, 165, 170, 185
Sse9I AATT 5 cut(s) 25, 106, 148, 161, 216
SsiI CCGC 2 cut(s) 31, 34
SspDI GGCGCC 1 cut(s) 46
SspMI CTAG 1 cut(s) 173
StyD4I CCNGG 1 cut(s) 93
TaqI TCGA 2 cut(s) 88, 152
TasI AATT 5 cut(s) 25, 106, 148, 161, 216
TauI GCSGC 2 cut(s) 34, 37
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TscAI CASTG 1 cut(s) 21
TseI GCWGC 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 210
TspRI CASTG 1 cut(s) 21
XapI RAATTY 3 cut(s) 25, 148, 216
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.